Previous Article | Next Article ![]()
Clinical and Diagnostic Laboratory Immunology, May 1998, p. 412-414, Vol. 5, No. 3
Institute of Veterinary
Pathology1 and
Institute of
Virology,2 University of Zurich, CH-8057 Zurich,
Switzerland, and
Laboratory of Veterinary Virology, University
of Gent, B-9822 Merelbeke, Belgium3
Received 24 September 1997/Returned for modification 5 January
1998/Accepted 3 March 1998
An immunohistochemistry method using formalin-fixed tissues, a
direct immunofluorescence method using cryostat sections, an enzyme-linked immunosorbent assay (ELISA), and a PCR method were compared for diagnosis in a litter of weaned pigs that had been experimentally inoculated with wild-type porcine epidemic diarrhea virus (PEDV) and killed between 6 and 60 h after onset of
diarrhea. The immunohistochemistry method proved to be as reliable as
direct immunofluorescence for diagnosis of PEDV in tissues collected postmortem. The good reliability of ELISA for investigating clinical samples was confirmed, whereas the PCR method used was ineffective.
Porcine epidemic diarrhea virus
(PEDV) is a widespread coronavirus causing enteric disease in swine
(9). Based on their good reliability and sensitivity, direct
immunofluorescence (IF) using cryostat sections of gut tissue and
enzyme-linked immunosorbent assay (ELISA) of fecal material are the
most commonly used detection methods at present (3, 4, 7,
9). However, additional methods have been recently developed with
potential for use in PEDV diagnostics, in particular, an
immunohistochemistry method (IHC) using formalin-fixed,
paraffin-embedded tissue (2) and a polymerase chain reaction
(PCR) using feces (8, 10). No comparative data are available
regarding the reliability of these four methods. The aim of this study
was to assess the suitability of IHC for use with formalin-fixed
paraffin-embedded gut tissues for diagnosis of PEDV infection in
comparison with IF, ELISA, and PCR. The tests were performed on
specimens obtained from an experiment designed to simulate as closely
as possible the natural disease. Specimens were sampled taking into
consideration that IHC and IF are postmortem methods whereas ELISA and
PCR are used in clinical practice mostly for investigation of fecal
specimens from living pigs.
A litter of seven healthy, 5-week-old, weaned pigs born from a sow
serologically negative for PEDV was purchased from a conventional farm
known to be free of relevant diseases. The pigs were housed together on
a flat-deck unit. One uninoculated control pig was euthanized at the
start of the experiment. The remaining six animals were inoculated per
os with 1 ml of wild-type PEDV (isolate CV777) stock diluted in 4 ml of
phosphate-buffered saline. The virus stock consisted of a
bacterium-free filtrate of small-intestine homogenate with contents
derived from a 1-day-old specific-pathogen-free piglet inoculated as
previously described (6). The animals were observed at
regular intervals for signs of diarrhea. After an incubation period of
39 h, all virus-inoculated pigs had watery feces. All animals were
euthanized by electrocution followed by exsanguination, except for pig
t9, which died as a result of concomitant fibrinous polyserositis,
polyarthritis, and meningitis due to Streptococcus suis. The
animals were designated pigs t6, t9, t24, t36, t48, and t60 according
to the time of death in hours after onset of diarrhea. The intestines
were removed as soon as possible after the death of the pigs; sampling
sites were designated A to G as shown in Fig.
1. Specimens from each animal were
collected and processed as indicated below.
1071-412X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Immunohistochemical Detection of Porcine Epidemic
Diarrhea Virus Compared to Other Methods
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References

View larger version (38K):
[in a new window]
FIG. 1.
Performance of different tests for detection of PEDV.
IHC. Tissues from sites A to G were fixed in formalin for 48 h and embedded in paraffin wax by standard methods. IHC detection of PEDV antigen was performed by using monoclonal antibody mcAb204, which was previously shown to be specific for M protein of PEDV (11). The reaction product was visualized by using a streptavidin-horseradish peroxidase immunogold-silver method as previously described (2). A duplicate of each section was incubated with phosphate-buffered saline instead of the primary antibody as a negative control. The amount of viral antigen in each site in the small intestine was determined, evaluating the approximate percentage of positive villi and villous enterocytes as described elsewhere (1). All tissues were also examined histopathologically by using sections stained with hematoxylin and eosin.
IF. Tissue specimens from sites C, D, E, and G were embedded in Methocel and frozen in a CO2-alcohol bath. Cryostat sections were cut, and a direct IF test using a porcine PEDV hyperimmune serum as previously described (7) was employed.
ELISA.
Intestinal contents were sampled from sites E, G, and
H, frozen in liquid nitrogen, stored at
70°C, and investigated by
using an antigen detection ELISA based on polyclonal antibodies against PEDV as previously described (3).
RT-PCR.
Tissue samples from sites C, D, F, and G were frozen
in liquid nitrogen and stored at
70°C until investigation with a
reverse transcription (RT)-PCR protocol described previously
(10). Briefly, RNA was extracted in 4 M guanidinium
thiocyanate and then in phenol and chloroform and reverse transcription
was accomplished with a specific antisense primer
(AACAAAGCCTGCCAATAAG) from the genetic region coding for
open reading frame 3. The cDNA obtained was then amplified by PCR using
the same primer and a sense primer (GTTAGCTCTTTTTCTAGACC)
representing a part of the leader sequence of PEDV. The
amplification products within the expected size of 394 bp were analyzed
on 1.5% agarose gels.
| |
ACKNOWLEDGMENTS |
|---|
This study was supported by the Swiss Federal Veterinary Services (grants 012.93.7 and 012.91.7).
The skillful technical assistance of the laboratory technical staff of the Institute of Veterinary Pathology, Zurich University, is greatly appreciated.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institut fuer Veterinaerpathologie der Universitaet Zuerich, Winterthurerstr. 268, CH-8057 Zuerich, Switzerland. Phone: 41 1 6358551. Fax: 41 1 6358908. E-mail: gufo{at}vetpath.unizh.ch.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bernasconi, C. 1996. Dissertation thesis. University of Zurich, Zurich, Switzerland. |
| 2. | Bernasconi, C., F. Guscetti, A. Utiger, K. Van Reeth, M. Ackermann, and A. Pospischil. 1995. Experimental infection of gnotobiotic piglets with a cell culture adapted porcine epidemic diarrhoea virus: clinical, histopathological, and immunohistochemical findings, p. 542-546. In M. Schwyzer, M. Ackermann, G. Bertoni, R. Kocherhans, K. McCullogh, M. Engels, R. Wittek, and R. Zanoni (ed.), Immunobiology of viral infections. Proceedings of the Third Congress of the European Society for Veterinary Virology. |
| 3. | Callebaut, P., P. Debouck, and M. Pensaert. 1982. Enzyme-linked immunosorbent assay for the detection of the coronavirus-like agent and its antibodies in pigs with porcine epidemic diarrhea. Vet. Microbiol. 7:295-306[Medline]. |
| 4. |
Carvajal, A.,
I. Lanza,
R. Diego,
P. Rubio, and P. Carmenes.
1995.
Evaluation of a blocking ELISA using monoclonal antibodies for the detection of porcine epidemic diarrhea virus and its antibodies.
J. Vet. Diagn. Invest.
7:60-64 |
| 5. | Coussement, W., R. Ducatelle, P. Debouck, and J. Hoorens. 1982. Pathology of experimental CV777 coronavirus enteritis in piglets. I. Histological and histochemical study. Vet. Pathol. 19:46-56[Abstract]. |
| 6. | Debouck, P., and M. Pensaert. 1980. Experimental infection of pigs with a new porcine enteric coronavirus, CV 777. Am. J. Vet. Res. 41:219-223[Medline]. |
| 7. | Debouck, P., M. Pensaert, and W. Coussement. 1981. The pathogenesis of an enteric infection in pigs, experimentally induced by the coronavirus-like agent, CV 777. Vet. Microbiol. 6:157-165. |
| 8. | Kweon, C.-H., J.-G. Lee, M.-G. Han, and Y.-B. Kang. 1997. Rapid diagnosis of porcine epidemic diarrhea virus infection by polymerase chain reaction. J. Vet. Med. Sci. 59:231-232[Medline]. |
| 9. | Pensaert, M. B. 1992. Porcine epidemic diarrhea, p. 293-298. In A. D. Leman, B. E. Straw, W. L. Mengeling, S. D'Allaire, and D. J. Taylor (ed.), Diseases of swine, 7th ed. Iowa State University Press, Ames. |
| 10. | Tobler, K., R. Kocherhans, and M. Ackermann. 1995. Detection of porcine epidemic diarrhoea coronavirus by RT-PCR, p. 483-490. In Y. Becker, and G. Darai (ed.), PCR: protocols for diagnosis of human and animal virus diseases. Springer-Verlag, Berlin, Germany. |
| 11. | Utiger, A., M. Rosskopf, F. Guscetti, and M. Ackermann. 1994. Preliminary characterization of a monoclonal antibody specific for a viral 27kD glycoprotein family synthesized in porcine epidemic diarrhoea virus infected cells. Adv. Exp. Med. Biol. 342:197-202. |
| 12. | van Nieuwstadt, A. P., and T. Zetstra. 1991. Use of two enzyme-linked immunosorbent assays to monitor antibody responses in swine with experimentally induced infection with porcine epidemic diarrhea virus. Am. J. Vet. Res. 52:1044-1050[Medline]. |
| 13. | Witte, K. H., D. Prager, H. Ernst, and H. Nienhoff. 1981. Die Epizootische Virusdiarrhoe (EVD). Tieraerztl. Umsch. 36:235-250. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»