Previous Article | Next Article 
Clinical and Diagnostic Laboratory Immunology, November 1998, p. 766-772, Vol. 5, No. 6
1071-412X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Use of the Cell Division Protein FtsZ as a Means of
Differentiating among Bartonella Species
Timothy M.
Kelly,1
Indira
Padmalayam,2 and
Barbara R.
Baumstark1,*
Department of Biology, Georgia State
University, Atlanta, Georgia 30302,1 and
Division of Viral and Rickettsial Diseases, Centers for
Disease Control and Prevention, Atlanta, Georgia
303332
Received 14 May 1998/Returned for modification 25 June
1998/Accepted 27 July 1998
 |
ABSTRACT |
Genes coding for homologs of the highly conserved cell division
protein FtsZ were isolated from Bartonella henselae and
Bartonella quintana, the causative agents of cat scratch
disease and trench fever, respectively. DNA fragments coding for the
ftsZ open reading frames (ORFs) were cloned into
Escherichia coli following PCR amplification with primers
based on the ftsZ sequence of the closely related species
Bartonella bacilliformis. The amino acid sequences predicted from the cloned B. henselae and B. quintana
ftsZ ORFs are 81 to 83% identical to the corresponding protein
in B. bacilliformis. Like the FtsZ protein of B. bacilliformis, the B. henselae and B. quintana homologs are about twice as large as the FtsZ proteins reported in most other organisms. Localized sequence differences within
the C-terminal coding regions of the Bartonella ftsZ genes were used as the basis for species-specific identification of these
organisms at both the DNA and protein levels. Oligonucleotide primers
which permit the amplification of an ftsZ fragment from each of the Bartonella species without amplifying DNA from
the other two species were designed. Anti-FtsZ antisera raised in rabbits against synthetic peptides corresponding to the relatively divergent C-terminal regions were shown via Western blot analysis to
react only with the FtsZ protein from the cognate
Bartonella species. These observations raise the
possibility that the differences in ftsZ sequences can be
used as the basis for diagnostic tests to differentiate among these
closely related pathogens.
 |
INTRODUCTION |
The genus Bartonella
consists of aerobic, fastidious, gram-negative bacilli belonging to the
alpha-2 subgroup of the class Proteobacteria. Bartonella
currently includes 11 species, 4 of which are recognized as human
pathogens. Bartonella bacilliformis is the etiologic agent
of bartonellosis (Carrion's disease), a biphasic disease endemic to
remote areas of South America. Bartonellosis is transmitted by the bite
of certain nocturnal sandflies, whose short flight ranges and
particular temperature and humidity requirements limit the spread of
the disease to the areas of endemicity. Humans are the only known
reservoir of B. bacilliformis. The primary, acute phase of
bartonellosis is characterized by fever, hemolytic anemia, and
bacteremia. In this phase, B. bacilliformis parasitizes almost 100% of the erythrocytes. The secondary, chronic phase is
characterized by skin lesions, referred to as verruga peruana, in which
B. bacilliformis invades endothelial cells, causing
hemoangiomas. Research interest in this organism has increased in
recent years due to a rural Peruvian epidemic in 1987 with a fatality
rate of 88% in untreated cases (10).
Bartonella henselae, a close relative of B. bacilliformis, is the causative agent of cat scratch disease (CSD)
and bacillary angiomatosis (BA). CSD is typically a benign and
self-limited condition lasting 6 to 12 weeks in untreated individuals.
Regional lymphadenopathy is the predominant clinical feature of CSD,
with 25 to 60% of patients reporting a cutaneous lesion at the site of
a cat scratch or bite (24). More serious symptoms, including encephalopathy and pulmonary disease, occur rarely.
BA is a newly recognized disease characterized by cutaneous and
subcutaneous vascular lesions which bear distinct clinical and
histological similarities to the lesions observed in the chronic secondary phase of bartonellosis. BA was first described in 1983, predominantly among patients infected with human immunodeficiency virus
(31). Since then, the clinical spectrum has expanded to include patients with proliferative vascular lesions affecting virtually every organ system, including bone, liver, and spleen (24). Independently, an unknown gram-negative pathogen was
isolated from human immunodeficiency virus patients with fever and
bacteremia, the symptoms of CSD, but these patients lacked vascular
lesions and were not recognized as having BA. Eventually it was shown that B. henselae is the causative agent of both CSD and BA
and that the domestic cat is a reservoir for the organism. The cat flea
(Ctenocephalides felis) was recently shown to be a vector for B. henselae, capable of transmitting the organism among
felines (4).
Bartonella quintana has also been associated with BA and is
the causative agent of trench fever, a disease that was prevalent among
troops during World War I. The human body louse was shown to be the
vector for B. quintana transmission, at least in the case of
trench fever. Another focus of B. quintana infections (referred to as "urban trench fever") has been identified among the
homeless population of Seattle, Wash. (24). No other
reservoir, including cats, has been demonstrated for B. quintana.
Recently, a 75-kDa antigen of B. bacilliformis was
identified as a homolog of FtsZ, an essential cell division protein
that is highly conserved among prokaryotes (23). The
N-terminal half (321 amino acids) of the B. bacilliformis
homolog, FtsZBb, exhibits 45 to 90% sequence identity with
other FtsZ proteins and contains all of the domains known to be
necessary for FtsZ cell division activities, including the GTP-binding
domain. In addition, the extreme C terminus of FtsZBb
contains a region of 14 amino acids which is conserved in almost all of
the currently characterized FtsZ proteins. However, FtsZBb
differs from most of the other FtsZ proteins reported to date in that
it contains a unique C-terminal domain, resulting in a protein almost
twice as large as the majority of the currently characterized FtsZ
homologs. The C-terminal half of FtsZBb (271 amino acids)
is very hydrophilic and is predicted to contain a high proportion of
antigenic sites based on computer modeling (23).
In this study, we report the isolation and characterization of
ftsZ homologs in B. henselae and B. quintana. We also describe the development of strategies to
identify and distinguish Bartonella species by using
ftsZ DNA and protein sequences.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
B.
bacilliformis KC584 (ATCC 35686) was grown on heart infusion agar
plates supplemented with 5% defibrinated rabbit blood (BBL-Becton
Dickinson, Cockeysville, Md.) at 28°C for 10 to 20 days. B. henselae Houston-1 (ATCC 49882) and B. quintana
Oklahoma (OK 90-268) and Fuller (CIP 103739; ATCC VR-358) were grown on the same medium at 37°C for 10 to 20 days. Bacteria were harvested and resuspended in phosphate-buffered saline. Escherichia
coli JM105 was grown in Luria broth (LB) or LB containing 50 µg
ampicillin per ml when transformed with plasmids derived from
pBluescript (Stratagene, La Jolla, Calif.) or pUC18 (Sigma, St. Louis,
Mo.) vectors.
DNA extraction.
Total genomic DNA was extracted from
Bartonella strains to serve as a template for PCR
amplification by a protocol described previously (1).
Plasmid DNA for sequencing was isolated with QIAGEN reagents, according
to the manufacturer's protocols (QIAGEN Inc., Chatsworth, Calif.).
PCR amplification.
PCR amplifications were performed with a
kit from Boehringer Mannheim (Indianapolis, Ind.). The 100-µl
reaction mixture (in 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM
KCl [pH 8.3]) consisted of template (10 ng), forward and reverse
primers (1 µg each), and a mixture of nucleotides (each at a final
concentration of 200 µM). Both high- and low-stringency protocols
were used. The high-stringency protocol consisted of 30 cycles of
94°C (1 min)-55°C (1 min)-72°C (3 min) followed by a 30-min
extension period at 72°C. In the low-stringency protocol, 27 cycles
under the conditions described above were preceded by three cycles of
94°C (1 min)-37°C (1 min)-72°C (3 min). PCR products were
purified with the QIAQUICK PCR purification system (QIAGEN).
Molecular cloning of ORFs coding for ftsZ
homologs.
Cloning of the gene coding for the FtsZ homolog of
B. bacilliformis (ftsZBb) was
described previously (23). Genes coding for the FtsZ
homologs of B. henselae (ftsZBh) and
B. quintana (ftsZBq) were cloned by
insertion of PCR products into pUC18. ftsZBh and
ftsZBq were amplified by a two-step strategy
with primers derived from the published sequence of
ftsZBb and preliminary sequence information on
ftsZBh. All primers for PCR and sequencing were
synthesized by a model 394 DNA synthesizer (Applied Biosystems, Foster
City, Calif.). The forward and reverse primer sequences used for
amplification of the 5' portion of the gene were 5'
GAGGTAAGAATTCTCAACGTGTTGGTCAG 3' (forward) and
5' CGCATAGAAGTATCATCCAACAACGG 3' (reverse). The forward
primer sequence was derived from a region located approximately 90 bp
upstream of the ftsZBb open reading frame (ORF)
and was modified to contain an EcoRI site (underlined). The
reverse primer corresponded to a sequence within the
ftsZBh ORF, located about 750 bp from the
initiation codon. For amplification of the 3' portion of the gene, the
sequence of the forward primer was 5' CCGTTGTTGGATGATACTTCTATGCG
3' while the sequences of the reverse primers were 5'
CTCTTTCGGATCCTATTCATTAATTCGCTTGGCGACG 3' for B. henselae and 5'
CTCTTTCGGATCCTATTCATTAGTTCGCTTGGCGACG 3' for B. quintana. In this case, the forward primer was derived from a sequence within the ftsZBh ORF overlapping that
of the reverse primer for the 5' amplification reaction. The reverse
primers corresponded to a sequence consisting of the final 21 bp of the ftsZBh (or ftsZBq) ORF
plus an additional 16 bp derived from sequence downstream of the
ftsZBb ORF, modified to contain a
BamHI site (underlined). The resulting amplification
products were gel purified with the QIAQUICK kit and then subjected to
another PCR containing only the flanking primers, resulting in a
product consisting of the entire ORF plus flanking regions containing
restriction enzyme sites. These PCR products were digested with
EcoRI and BamHI and ligated into the
appropriately digested and dephosphorylated pUC18 vector. The ligation
reactions were transformed into competent E. coli JM105
cells which were then grown on LB containing 50 µg of ampicillin per
ml to select cells harboring the recombinant plasmid (28).
Incorporation of the PCR products into the vector was verified by gel
electrophoresis of the recombinant plasmids. Plasmids containing PCR
products derived from B. henselae and B. quintana
were designated pUCBH-Z and pUCBQ-Z, respectively. Expression of
FtsZBh and FtsZBq in E. coli was
confirmed via Western blotting.
DNA sequencing.
The nucleotide sequences of both strands of
pUCBH-Z and pUCBQ-Z were obtained by the methods of Sanger et al.
(29) with an Applied Biosystems model 373 automated nucleic
acid sequencer. These sequences were verified through sequence analysis
of ftsZ amplification products from the chromosomes of
B. henselae and B. quintana. Parallel DNA
sequence analysis was also carried out on the previously cloned
ftsZBb (23) sequence and on
ftsZ amplification products from the chromosome of B. bacilliformis. The ftsZBb sequence derived
from this analysis was found to differ from the previously published
sequence for this ORF at 19 positions, resulting in 13 alterations of
the amino acid sequence. Following verification, the corrected
ftsZBb sequence was submitted to GenBank
(accession no. AF007266) to reflect these changes.
DNA sequence analysis.
DNA and protein sequences were
analyzed with the software package MacDNAsis (Hitachi Software
Engineering America Ltd., South San Francisco, Calif.). Multiple
protein sequence alignments were performed with the software package
MacVector (Oxford Molecular Group, Beaverton, Oreg.).
Agarose gel electrophoresis.
For cloning of ftsZ
homologs, purified PCR products were electrophoresed through 0.8%
agarose gels in Tris-borate buffer (28) containing ethidium
bromide. Appropriate fragments were extracted with the QIAQUICK gel
purification kit (QIAGEN) for additional rounds of PCR or restriction
enzyme digestion. For PCR-based diagnostics, purified PCR products were
subjected to electrophoresis through 1.0% agarose gels in Tris-acetate
buffer (28). Gels were stained with 10 µg of ethidium
bromide per ml and photographed.
Peptide synthesis and antibody production.
Peptides were
synthesized by a model 431A peptide synthesizer (Applied Biosystems).
Peptides were dissolved in water at a concentration of 2 mg/ml and
diluted 1:1 with Freund's complete adjuvant (Sigma). The resulting
1-mg/ml inoculant was injected into New Zealand White rabbits
(Myrtle's Rabbitry Inc., Thompson Station, Tenn.) for antibody
production. Animals were boosted after 2 weeks with an inoculant
containing 1 mg of peptide/ml in Freund's incomplete adjuvant (Sigma).
Rabbits were bled at 3-week intervals, and serum was purified by
centrifugation according to standard procedures (28).
SDS-polyacrylamide gel electrophoresis and Western blot
analysis.
Proteins from E. coli and
Bartonella strains were solubilized in 1× sample buffer
(13) at 100°C for 5 min and subjected to electrophoresis
on precast 12% Tris-glycine gels (Bio-Rad, Hercules, Calif.). Each gel
included samples of protein extracts isolated from E. coli
(pUC18) and from E. coli clones expressing cognate
Bartonella FtsZ proteins. Gels were run in
Tris-glycine-sodium dodecyl sulfate (SDS) running buffer (NOVEX, San
Diego, Calif.) at 100 V. Separated proteins were electrotransferred to
0.45-µm-pore-size nitrocellulose membranes (NOVEX) according to the
protocol of Towbin et al. (32). Transfer was performed in
Tris-glycine buffer with 20% methanol for 1 h at 100 V with
cooling. Membranes were blocked in Tris-buffered saline-Tween 20 containing 5% nonfat dry milk. Membranes were incubated with a primary
antibody solution consisting of rabbit antipeptide antiserum diluted in
blocking buffer. The secondary antibody was goat anti-rabbit
immunoglobulin G conjugated to horseradish peroxidase (Kirkegaard and
Perry Laboratories, Inc., Gaithersburg, Md.) diluted 1:5,000 in
blocking buffer. Membranes were developed with a standard chromogenic
substrate (TMB membrane peroxidase substrate system; Kirkegaard and
Perry Laboratories, Inc.).
Nucleotide sequence accession numbers.
The nucleotide
sequence of the 1,864-bp fragment of B. henselae DNA
contained in pUCBH-Z has been deposited into the GenBank database and
has been assigned accession no. AF061746. The nucleotide sequence of
the 1,893-bp fragment of B. quintana DNA contained in
pUCBQ-Z has been assigned accession no. AF061747.
 |
RESULTS |
DNA and protein sequence analysis.
Nucleotide sequence
analysis of the 1,864-bp fragment of B. henselae DNA
contained in pUCBH-Z revealed an ORF of 1,743 bp. This ORF encodes a
protein of 581 amino acids (designated FtsZBh) with a
predicted molecular mass of 62.3 kDa. Sequence analysis of the 1,893-bp
fragment of B. quintana DNA contained in pUCBQ-Z revealed an
ORF of 1,770 bp. This ORF encodes a protein of 590 amino acids
(designated FtsZBq) with a predicted molecular mass of 63.8 kDa. About 8 nucleotides upstream of the start codon for each ORF is a
sequence (AAGAGG) that is homologous to the consensus ribosome binding site of E. coli and other prokaryotes
(30).
FtsZBh and FtsZBq exhibit 83 and 81% identity,
respectively, to FtsZBb and are 91% identical to one
another (Fig. 1). The degree of
conservation for the three proteins is particularly striking within the
N-terminal domains, which exhibit 98 to 99% identity over a length of
321 amino acids. The 321-amino-acid N-terminal halves of
FtsZBh and FtsZBq exhibit 63 and 61% identity, respectively, to the N-terminal 321 amino acids of the FtsZ homolog from E. coli (FtsZEc). Like FtsZBb
(23), FtsZBh and FtsZBq contain all
of the functional domains identified in FtsZEc within their N-terminal domains, including the glycine-rich GTP-GDP binding pocket
(residues 109 to 115). This region contains the amino acid sequence
GGGTGTG, a sequence which is highly homologous to the tubulin signature motif (GGGTGSG) thought to be involved in
GTP binding in eukaryotes (15).

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of the amino acid sequences of the FtsZ
homologs of E. coli (EC), B. bacilliformis (BB),
B. henselae (BH), and B. quintana (BQ). Regions
of identity are indicated by dark shading; regions of similarity are
indicated by light shading. The peptides used to produce
species-specific antisera are underlined in each Bartonella
FtsZ homolog sequence.
|
|
The C-terminal domains of FtsZBh (260 amino acids) and
FtsZBq (269 amino acids) are highly conserved, exhibiting
81% identity. However, the C-terminal domains of the B. henselae and B. quintana homologs both exhibit
considerably less homology to the 271-amino-acid C-terminal domain of
FtsZBb (57 and 55% identity, respectively).
PCR diagnostics.
The differences in DNA sequence within the
C-terminal regions of the ftsZBb,
ftsZBh, and ftsZBq ORFs
were exploited to design a species-specific PCR-based diagnostic test.
Genomic DNA from B. bacilliformis, B. henselae,
and B. quintana was incubated with primers designed to
correspond either to sequences of the ftsZ gene that are
highly conserved among prokaryotes or to regions that differ
significantly among the three Bartonella species (Table 1 and Fig.
2). Primers corresponding to the
conserved regions of ftsZ permitted amplification of a
product of approximately 1,600 bp from all three
Bartonella species under low-stringency conditions (Fig.
3).

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of the DNA sequences of the Bartonella
ftsZ homologs within the region of PCR primer design. The
sequences given correspond to nucleotides 1041 to 1657 of the
ftsZBb ORF, nucleotides 1041 to 1627 of the
ftsZBh ORF, and nucleotides 1041 to 1654 of the
ftsZBq ORF. Sequences used to design
species-specific primers for PCR diagnostic studies are underlined in
each homolog sequence, with arrows indicating the 3' end.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of Bartonella species via PCR
amplification of ftsZ. DNA Molecular Weight Marker VI
(Boehringer Mannheim) in lane 1 consists of the following fragments:
2,176, 1,766, 1,230, 1,033, 653, 517, 453, 394, and 298 bp. Lanes 2 to
4, reaction mixtures containing conserved primers and chromosomal DNA
from B. bacilliformis (lane 2), B. henselae (lane
3), and B. quintana Oklahoma (lane 4); lanes 5 to 7, reaction mixtures containing ftsZBb-specific
primers and chromosomal DNA from B. bacilliformis (lane 5),
B. henselae (lane 6), and B. quintana (lane 7);
lanes 8 to 10, reaction mixtures containing
ftsZBh-specific primers and chromosomal DNA from
B. bacilliformis (lane 8), B. henselae (lane 9),
and B. quintana (lane 10); lanes 11 to 13, reaction mixtures
containing ftsZBq-specific primers and
chromosomal DNA from B. bacilliformis (lane 11), B. henselae (lane 12), and B. quintana (lane 13).
|
|
In contrast, the use of primers corresponding to divergent regions of
the ftsZ gene resulted in amplification only with those primers derived from the sequence of the cognate species (Fig. 3). All
species-specific PCRs were performed under high-stringency conditions.
PCR with the B. bacilliformis-specific primers resulted in a
product of 612 bp in B. bacilliformis and no product in
B. henselae or B. quintana. Incubation with the
B. henselae-specific primers resulted in a product of 354 bp
in B. henselae only. Finally, PCR including the B. quintana-specific primers resulted in a product of 367 bp in
B. quintana only. From these observations, we conclude that
a PCR-based diagnostic test utilizing the differences in ftsZ successfully distinguishes the genomes of B. henselae, B. quintana, and B. bacilliformis.
Serology.
A comparison of the ORFs coding for
FtsZBb, FtsZBh, and FtsZBq reveals
that sequence divergence at the amino acid level, although limited, is
predominantly localized within the C-terminal half of each protein.
According to computer modeling predictions, the C-terminal regions also
contain a high proportion of antigenic sites. Based on these
considerations, synthetic peptides were designed for use in the
development of a serological test to distinguish among B. bacilliformis, B. henselae, and B. quintana.
Peptides corresponding to the regions of greatest divergence were
synthesized and injected into rabbits to generate species-specific
antisera (Table 1 and Fig. 1). Western blot analysis was then used to identify immunoreactive proteins extracted from the three
Bartonella species. In all cases, a protein corresponding to
the size of FtsZ (75 kDa) was observed only in extracts reacted with
antisera from the cognate Bartonella species (Fig.
4). No immunoreactive protein of this
size was detected when extracts were reacted with antisera generated in
response to a heterologous peptide sequence. B. bacilliformis extracts were found to contain an additional immunoreactive protein of about 55 kDa that reacts with both B. bacilliformis- and B. henselae-specific antisera. A
protein of about 150 kDa recognized by antibodies to B. quintana was also observed in B. bacilliformis extracts
and in an extract derived from the Oklahoma strain of B. quintana. In both of these cases, however, the distinct migration
patterns of these proteins make them clearly distinguishable from FtsZ.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Identification of Bartonella species via
Western blotting with anti-FtsZ peptide antisera. Anti-peptide BB1
antiserum was diluted 1:5,000 in blocking buffer. Anti-peptide BH3
antiserum and anti-peptide BQ5 antiserum were diluted 1:1,000 in
blocking buffer. Arrows indicate the positions of Bartonella
FtsZ homologs expressed from ftsZ-encoding recombinant
plasmids in E. coli JM105. The MultiMark molecular mass
protein standard (NOVEX) consists of the following sizes: 250, 148, 60, 42, 30, and 22 kDa. Lanes: 1, B. bacilliformis cell lysate;
2, B. henselae cell lysate; 3, B. quintana
Oklahoma cell lysate; 4, B. quintana Fuller cell lysate.
|
|
The observed molecular mass of 75 kDa differs significantly from the
predicted molecular mass of about 63 kDa. Similar discrepancies in the
molecular weight of FtsZ have previously been reported for B. bacilliformis and Rhizobium meliloti (17,
23). In these cases, the discrepancies were attributed to
aberrant migration of FtsZ through SDS-polyacrylamide gels.
 |
DISCUSSION |
The expression of ftsZ and the mechanism of action of
its gene product in E. coli have been studied extensively.
In E. coli, FtsZ initiates division by forming the
cytokinetic ring at the division site, leading to circumferential
invagination of the cytoplasmic membrane and cell wall followed by
formation of the division septum (15). In nondividing cells,
FtsZ is produced in amounts of 10,000 to 20,000 molecules per cell
(6) and is recruited from the cytoplasm during division to
form the cytokinetic ring on the inner surface of the cell membrane.
Ring formation requires the self-assembly of FtsZ monomers, a process
which is dependent on the GTP-binding activity of FtsZ (21).
The importance of FtsZ in cell division is reflected in its strong
conservation among the eubacteria. The identification of FtsZ homologs
in both gram-positive and gram-negative bacteria (5)
suggests that the role of this protein in cell division may be shared
among all bacteria. FtsZ homologs have recently been reported among several members of the archaebacteria as well (33).
In this study, we report the sequences of FtsZBh and
FtsZBq, two FtsZ homologs from the closely related species
B. henselae and B. quintana. Within their
N-terminal domains, FtsZBh and FtsZBq exhibit
high degrees of similarity to the FtsZ family of proteins, features
they share with the B. bacilliformis homolog,
FtsZBb. Like FtsZBb, however,
FtsZBh and FtsZBq each contain an additional C-terminal region of about 300 amino acids that is not present in most
of the other FtsZ homologs. The level of amino acid sequence identity
between the FtsZ homologs of B. henselae and B. quintana is 91% over the entire length of the proteins.
FtsZBh and FtsZBq are slightly less homologous
to FtsZBb, exhibiting sequence identities of 83 and 81%,
respectively. The higher degree of conservation observed between the
B. henselae and B. quintana homologs compared with that of B. bacilliformis is consistent with the pattern
of relatedness in Bartonella based on comparisons of the
citrate synthase gene sequence reported by Norman et al.
(22).
Of the currently characterized FtsZ proteins, the Bartonella
homologs appear to be most similar to FtsZRm1, a homolog
from R. meliloti which also contains an extended C-terminal
domain (17). The N-terminal domains of the
Bartonella homologs and FtsZRm1 are 84 to 85%
identical, with the degree of identity decreasing to approximately 35%
in the C-terminal region. Overall, FtsZRm1 exhibits 68%
identity with FtsZBh, 66% identity with
FtsZBq, and 65% identity with FtsZBb. In
addition to those from Bartonella and Rhizobium,
a large FtsZ protein containing a unique C-terminal domain
(FtsZAt) has been reported for Agrobacterium
tumefaciens (5). The recently published sequence for
the A. tumefaciens homolog (16) displays 67%
identity with FtsZBh and 65% identity with
FtsZBq and FtsZBb. The N-terminal domains of
the Bartonella homologs and FtsZAt are 83 to
85% identical. Significantly, all of the bacteria reported to possess
large FtsZ homologs belong to the alpha-2 subgroup of
Proteobacteria, and they all interact closely with
eukaryotic cells. The relationship with eukaryotic cells may be
pathogenic, as in the case of Bartonella and A. tumefaciens, or endosymbiotic, as in the case of R. meliloti.
FtsZBb has been shown previously (23) to be
recognized both by antiserum raised against E. coli FtsZ and
by anti-Bartonella serum isolated from human patients. These
antisera recognize different domains of the protein, however, with the
E. coli antiserum recognizing the conserved N-terminal
domain and the human anti-Bartonella antiserum exhibiting
specificity for the unique C-terminal domain. These observations have
led to the hypothesis that FtsZBb is associated with the
cell membrane with the C-terminal domain exposed to the bacterial cell
surface, allowing it to serve as an antigen during infection
(23). Support for this theory comes from the observation that the 75-kDa antigen of B. bacilliformis is present in
membrane fractions of lysed cells (12, 20).
The differences within the C-terminal regions of the Bartonella
ftsZ ORFs, although few in number, were sufficient to allow us to
develop strategies for the differentiation of B. henselae, B. quintana, and B. bacilliformis at both the DNA
and protein levels. Since the diseases caused by these organisms can
produce symptoms that are clinically and histologically similar, a
rapid, reproducible method for identifying these pathogens is highly desirable. Because Bartonella species are notoriously
difficult to culture by traditional means, many clinicians have relied
on PCR-based and serological methods to diagnose these disorders.
PCR-based diagnostic procedures for differentiating
Bartonella species have been available for several years.
The first description of a PCR-based diagnostic test (26)
utilized primers designed for the amplification of
Bartonella 16S rRNA gene sequences, but these primers were
not genus specific and resulted in amplification of rRNA gene fragments
from many other Proteobacteria. Therefore, use of this test
requires direct sequence analysis of amplified DNA for identification
at the species level. More recently, protocols involving PCR
amplification of an htrA-like fragment followed by
hybridization of a species-specific probe (2),
PCR-restriction fragment length polymorphism with gltA
(22), and repetitive extragenic palindromic PCR
(27) have been described for distinguishing among
Bartonella species. The use of primers specific for unique sequences within the C-terminal region of ftsZ described
here requires only one round of PCR and avoids some of the problems with specificity and consistency reported for other protocols. We are
currently investigating the capability of the primers described here to
amplify ftsZ fragments from multiple strains within the three Bartonella species. In addition, the utility of the
ftsZ primers as tools for diagnosis of clinical specimens is
currently being explored.
PCR-based tests commonly use lymph node biopsy specimens as sources of
Bartonella DNA for clinical diagnosis. Many physicians prefer serological methods for diagnosis where possible because they do
not require invasive procedures to acquire antigen. The serological
assays currently used most frequently are the indirect fluorescence
assay (IFA) and the enzyme-linked immunoassay, but the diagnostic value
of these tests is questionable due to low sensitivity. The reported
success in detecting B. henselae by IFA has ranged from 54 to 88% in patients with clinical CSD (9, 11, 24). A recent
study specifically aimed at evaluating the diagnostic value of B. henselae-based IFA in patients with clinical CSD reported
sensitivities ranging from 31.8 to 40.9% for anti-B. henselae immunoglobulin G, depending on the method of antigen preparation (3). In some cases, these variations may reflect differences in the definition of clinical CSD. Recently, a new serotype
of B. henselae was described (8), and it now
appears that B. henselae exists as a widely distributed
group of serovariant strains (18). This antigenic variation
among strains may help to explain the inconsistent IFA results.
A matter of significant concern in the use of IFA and other serological
tests is the potential for misdiagnosis due to cross-reactivity. Serological cross-reactions have been observed between B. henselae and B. quintana antigens (7) and
also between Bartonella species and other bacterial
pathogens, such as Coxiella burnetii and
Chlamydia species (14, 19). Such cross-reactivity
represents a serious problem in the diagnosis of disorders caused by
these agents. Endocarditis, for example, can be caused by B. henselae, B. quintana, C. burnetii, and at
least two Chlamydia species. Since the antibiotic regimens
used to treat infections caused by these pathogens differ significantly, proper diagnosis is critical. We are currently investigating the utility of the synthetic FtsZ peptides described here
as species-specific antigens for serological diagnosis of Bartonella-related disorders.
In summary, we have described the use of the cell division gene
ftsZ to differentiate among three closely related
Bartonella species, each of which is a distinct human
pathogen. These studies may provide a basis for reproducible molecular
diagnosis of CSD and related disorders.
 |
ACKNOWLEDGMENTS |
We are grateful for the technical assistance provided by Judy
Cooper in growing the B. henselae and B. quintana
strains and to members of the Biology Core Facility at Georgia State
University for DNA sequence analysis and synthesis of primers and
peptides. We also thank Burt Anderson, University of South Florida, for providing B. quintana Oklahoma.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, Georgia State University, P.O. Box 4010, Atlanta, GA
30302-4010. Phone: (404) 651-3156. Fax: (404) 651-2509. E-mail:
biobrb{at}panther.gsu.edu.
 |
REFERENCES |
| 1.
|
Anderson, B.,
C. Goldsmith,
A. Johnson,
I. Padmalayam, and B. Baumstark.
1994.
Bacteriophage-like particle of Rochalimaea henselae.
Mol. Microbiol.
13:67-73[Medline].
|
| 2.
|
Anderson, B.,
K. Sims,
R. Regnery,
L. Robinson,
M. J. Schmidt,
S. Goral,
C. Hager, and K. Edwards.
1994.
Detection of Rochalimaea henselae DNA in specimens from cat scratch disease patients by PCR.
J. Clin. Microbiol.
32:942-948[Abstract/Free Full Text].
|
| 3.
|
Bergmans, A. M. C.,
M. F. Peeters,
J. F. P. Schellekens,
M. C. Vos,
L. J. M. Sabbe,
J. M. Ossewaarde,
H. Verbakel,
H. J. Hooft, and L. M. Schouls.
1997.
Pitfalls and fallacies of cat scratch disease serology: evaluation of Bartonella henselae-based indirect fluorescence assay and enzyme-linked immunoassay.
J. Clin. Microbiol.
35:1931-1937[Abstract].
|
| 4.
|
Chomel, B. B.,
R. W. Kasten,
K. Floyd-Hawkins,
B. Chi,
K. Yamamoto,
J. Roberts-Wilson,
A. N. Gurfield,
R. C. Abbott,
N. C. Pederson, and J. E. Koehler.
1996.
Experimental transmission of Bartonella henselae by the cat flea.
J. Clin. Microbiol.
34:1952-1956[Abstract].
|
| 5.
|
Corton, J. C.,
J. E. Ward, Jr., and J. Lutkenhaus.
1987.
Analysis of cell division gene ftsZ (sulB) from gram-negative and gram-positive bacteria.
J. Bacteriol.
169:1-7[Abstract/Free Full Text].
|
| 6.
|
Dai, K., and J. Lutkenhaus.
1992.
The proper ratio of FtsZ to FtsA is required for cell division to occur in Escherichia coli.
J. Bacteriol.
174:6145-6151[Abstract/Free Full Text].
|
| 7.
|
Dalton, M. J.,
L. E. Robinson,
J. Cooper,
R. L. Regnery,
J. G. Olsen, and J. E. Childs.
1995.
Use of Bartonella antigens for serologic diagnosis of cat-scratch disease at a national referral center.
Arch. Intern. Med.
155:1670-1676[Abstract].
|
| 8.
|
Drancourt, M.,
R. Birtles,
G. Chaumentin,
F. Vandenesch,
J. Etienne, and D. Raoult.
1996.
New serotype of Bartonella henselae in endocarditis and cat-scratch disease.
Lancet
347:441-443[Medline].
|
| 9.
|
Flexman, J. P.,
S. C. A. Chen,
D. J. Dickeson,
J. W. Pearman, and G. L. Gilbert.
1997.
Detection of antibodies to Bartonella henselae in clinically diagnosed cat scratch disease.
Med. J. Aust.
166:532-535[Medline].
|
| 10.
|
Gray, G. C.,
A. A. Johnson,
S. A. Thornton,
W. A. Smith,
J. Knobloch,
P. W. Kelley,
L. O. Escudero,
M. A. Huayda, and F. S. Wignall.
1990.
An epidemic of Oroya Fever in the Peruvian Andes.
Am. J. Trop. Med. Hyg.
42:215-221.
|
| 11.
|
Hamilton, D. H.,
K. M. Zangwill,
J. L. Hadler, and M. L. Cartter.
1995.
Cat-scratch disease Connecticut, 1992-1993.
J. Infect. Dis.
172:570-573[Medline].
|
| 12.
|
Knobloch, J.
1988.
Analysis and preparation of Bartonella bacilliformis antigens.
Am. J. Trop. Med. Hyg.
39:173-178.
|
| 13.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 14.
|
La Scola, B., and D. Raoult.
1996.
Serological cross-reactions between Bartonella quintana, Bartonella henselae, and Coxiella burnetii.
J. Clin. Microbiol.
34:2270-2274[Abstract].
|
| 15.
|
Lutkenhaus, J.
1993.
FtsZ ring in bacterial cytokinesis.
Mol. Microbiol.
9:403-409[Medline].
|
| 16.
|
Ma, X.,
Q. Sun,
R. Wang,
G. Singh,
E. L. Jonietz, and W. Margolin.
1997.
Interactions between heterologous FtsA and FtsZ proteins at the FtsZ ring.
J. Bacteriol.
179:6788-6797[Abstract/Free Full Text].
|
| 17.
|
Margolin, W.,
J. C. Corbo, and S. R. Long.
1991.
Cloning and characterization of a Rhizobium meliloti homolog of the Escherichia coli cell division gene ftsZ.
J. Bacteriol.
173:5822-5830[Abstract/Free Full Text].
|
| 18.
|
Maurin, M.,
R. Birtles, and D. Raoult.
1997.
Current knowledge of Bartonella species.
Eur. J. Clin. Microbiol. Infect. Dis.
16:487-506[Medline].
|
| 19.
|
Maurin, M.,
F. Eb,
J. Etienne, and D. Raoult.
1997.
Serological cross-reactions between Bartonella and Chlamydia species: implications for diagnosis.
J. Clin. Microbiol.
35:2283-2287[Abstract].
|
| 20.
|
Minnick, M. F.
1994.
Identification of outer membrane proteins of Bartonella bacilliformis.
Infect. Immun.
62:2644-2648[Abstract/Free Full Text].
|
| 21.
|
Mukherjee, A., and J. Lutkenhaus.
1994.
Guanine nucleotide-dependent assembly of FtsZ into filaments.
J. Bacteriol.
176:2754-2758[Abstract/Free Full Text].
|
| 22.
|
Norman, A. F.,
R. Regnery,
P. Jameson,
C. Greene, and D. C. Krause.
1995.
Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene.
J. Clin. Microbiol.
33:1797-1803[Abstract].
|
| 23.
|
Padmalayam, I.,
B. Anderson,
M. Kron,
T. Kelly, and B. Baumstark.
1997.
The 75-kilodalton antigen of Bartonella bacilliformis is a structural homolog of the cell division protein FtsZ.
J. Bacteriol.
179:4545-4552[Abstract/Free Full Text].
|
| 24.
|
Regnery, R., and J. Tappero.
1995.
Unraveling mysteries associated with cat-scratch disease, bacillary angiomatosis, and related syndromes.
Emerg. Infect. Dis.
1:16-21[Medline].
|
| 25.
|
Regnery, R. L.,
J. G. Olson,
B. A. Perkins, and W. Bibb.
1992.
Serological response to "Rochalimaea henselae" antigen in suspected cat-scratch disease.
Lancet
339:1443-1445[Medline].
|
| 26.
|
Relman, D. A.,
J. S. Loutit,
T. M. Schmidt,
S. Falkow, and L. S. Tompkins.
1990.
The agent of bacillary angiomatosis: an approach to the identification of uncultured pathogens.
N. Engl. J. Med.
323:1573-1580[Abstract].
|
| 27.
|
Rodriguez-Barradas, M. C.,
R. J. Hamill,
E. D. Houston,
P. R. Georghiou,
J. E. Clarridge,
R. L. Regnery, and J. E. Koehler.
1995.
Genomic fingerprinting of Bartonella species by repetitive element PCR for distinguishing species and isolates.
J. Clin. Microbiol.
33:1089-1093[Abstract].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 30.
|
Shine, J., and L. Dalgarno.
1974.
The 3' terminal sequence of E. coli 16S ribosomal RNA: complementarity to nonsense triplets and ribosomal binding sites.
Proc. Natl. Acad. Sci. USA
71:1342-1346[Abstract/Free Full Text].
|
| 31.
|
Stoler, M. H.,
T. A. Bonfiglio,
R. T. Steigbigel, and M. Pereira.
1983.
An atypical subcutaneous infection associated with acquired immune deficiency syndrome.
Am. J. Clin. Pathol.
80:714-718[Medline].
|
| 32.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 33.
|
Wang, X., and J. Lutkenhaus.
1996.
FtsZ ring: the eubacterial division apparatus conserved in archaebacteria.
Mol. Microbiol.
21:313-319[Medline].
|
Clinical and Diagnostic Laboratory Immunology, November 1998, p. 766-772, Vol. 5, No. 6
1071-412X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Maggi, R. G., Breitschwerdt, E. B.
(2005). Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species. J. Clin. Microbiol.
43: 1171-1176
[Abstract]
[Full Text]
-
Zeaiter, Z., Liang, Z., Raoult, D.
(2002). Genetic Classification and Differentiation of Bartonella Species Based on Comparison of Partial ftsZ Gene Sequences. J. Clin. Microbiol.
40: 3641-3647
[Abstract]
[Full Text]
-
Houpikian, P., Raoult, D.
(2001). 16S/23S rRNA Intergenic Spacer Regions for Phylogenetic Analysis, Identification, and Subtyping of Bartonella Species. J. Clin. Microbiol.
39: 2768-2778
[Abstract]
[Full Text]
-
Handley, S. A., Regnery, R. L.
(2000). Differentiation of Pathogenic Bartonella Species by Infrequent Restriction Site PCR. J. Clin. Microbiol.
38: 3010-3015
[Abstract]
[Full Text]
-
Jensen, W. A., Fall, M. Z., Rooney, J., Kordick, D. L., Breitschwerdt, E. B.
(2000). Rapid Identification and Differentiation of Bartonella Species Using a Single-Step PCR Assay. J. Clin. Microbiol.
38: 1717-1722
[Abstract]
[Full Text]
-
Ehrenborg, C., Wesslén, L., Jakobson, A., Friman, G., Holmberg, M.
(2000). Sequence Variation in the ftsZ Gene of Bartonella henselae Isolates and Clinical Samples. J. Clin. Microbiol.
38: 682-687
[Abstract]
[Full Text]
-
Mallqui, V., Speelmon, E. C., Verastegui, M., Maguina-Vargas, C., Pinell-Salles, P., Lavarello, R., Delgado, J., Kosek, M., Romero, S., Arana, Y., Gilman, R. H.
(2000). Sonicated Diagnostic Immunoblot for Bartonellosis. CVI
7: 1-5
[Abstract]
[Full Text]
-
Bereswill, S., Hinkelmann, S., Kist, M., Sander, A.
(1999). Molecular Analysis of Riboflavin Synthesis Genes in Bartonella henselae and Use of the ribC Gene for Differentiation of Bartonella Species by PCR. J. Clin. Microbiol.
37: 3159-3166
[Abstract]
[Full Text]