Previous Article | Next Article 
Clinical and Diagnostic Laboratory Immunology, January 1999, p. 24-29, Vol. 6, No. 1
1071-412X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Evaluation of Recombinant Dense Granule Antigen 7 (GRA7) of Toxoplasma gondii for Detection of Immunoglobulin
G Antibodies and Analysis of a Major Antigenic Domain
Dirk
Jacobs,1,*
Martine
Vercammen,2 and
Eric
Saman1
Innogenetics NV, Ghent
B-9052,1 and
Pasteur Instituut Brussel,
Brussels B-1180,2 Belgium
Received 10 July 1998/Accepted 7 October 1998
 |
ABSTRACT |
Dense granule protein 7 (GRA7) of Toxoplasma gondii was
expressed in Escherichia coli as a fusion protein. The
leader peptide contained a 25-amino-acid mouse tumor necrosis factor
fragment and six histidyl residues. After purification by metal chelate affinity chromatography, the antigen was evaluated in an enzyme-linked immunosorbent assay for detection of immunoglobulin G (IgG). For two
sets of IgG-positive human serum samples, obtained from routine screening, an overall sensitivity of 81% was obtained. For
chronic-phase sera, the sensitivity of detection was 79%, but
chronic-phase sera with low titers were more difficult to detect (65%
sensitivity for sera with immunofluorescence titer of 1/64). When GRA7
was combined with Tg34AR (rhoptry protein 2 C-terminal fragment), the
sensitivity rose to 96%. For a set of acute-phase serum samples tested
on GRA7, the sensitivity of detection was 94%, and high-titer IgM-positive sera were detected at an especially high rate. In contrast, when Tg34AR was used, the sensitivity was only 85% for this
latter set of serum samples. Three truncated GRA7 fragments containing
the same leader peptide as that of recombinant GRA7 were produced. The
shortest fragment (97 N-terminal amino acids) was not reactive with
human sera or with a specific anti-GRA7 monoclonal antibody, while the
two larger fragments were reactive. The most important antigenic domain
of GRA7 for human sera was localized between residues 97 and 146. The
epitope for the specific monoclonal antibody could be further
narrowed down by the use of synthetic peptides, but this epitope is
not recognized by sera from T. gondii-infected humans.
These results indicate that GRA7 may be considered as an additional
tool for studying the immune response to T. gondii.
 |
INTRODUCTION |
Toxoplasmosis, caused by the
apicomplexan parasite Toxoplasma gondii, is generally
clinically asymptomatic in healthy individuals but may cause severe
complications in pregnant women and immunocompromised patients
(23). If infection occurs during pregnancy, the parasite can
cross the placental barrier and cause severe damage to the fetus. In
AIDS patients, toxoplasmic encephalitis can be life-threatening (12).
A diagnosis of toxoplasmosis is usually based on serological assays.
Comparison of immunoglobulin G (IgG) levels with IgM and/or IgA levels
is used to differentiate between chronic and acute infections. Most
commercial serological assays detect antibodies by means of natural
antigens originating from T. gondii grown on host cells or
in the peritoneal cavity of mice. The production of these antigens is
rather expensive, and the constant quality of the antigen preparations
cannot be easily guaranteed. Such antigens can possibly be contaminated
by host cell material. The use of recombinant antigens could overcome
these drawbacks. Also, selected antigens that are characteristic for
the acute or chronic stages of the infection could serve as a tool to
discriminate between both stages.
In recent years, many toxoplasma genes have been cloned, and several
genes or gene fragments have been expressed in heterologous systems.
Until now, only a limited number of recombinant antigens have been
tested in an enzyme-linked immunosorbent assay (ELISA) and/or their
B-cell epitopes were analyzed. The first fragments to be expressed,
as glutathione S-transferase (GST) fusions, were H4 and H11
(10, 26), of which H11 was later shown to be a GRA4 fragment
(15). Recently, B-cell epitopes of this antigen were
analyzed (16). GRA2 also was produced as a GST fusion, and
the B-cell epitopes were studied (14, 17). Recombinant SAG2 was also tested for use in an ELISA, after removal of the GST
fusion partner (21). SAG1 was extensively studied and was expressed in CHO cells and by use of the Sindbis virus expression system (11, 29). Recently, a SAG1 fragment missing the
signal peptide and devoid of the C-terminal hydrophobic domain was
produced as a histidine fusion protein in Escherichia coli
(7). SAG1 B-cell epitopic regions were studied by several
groups (18, 28).
Cloning of ROP2 (1, 25) allowed the expression of a ROP2
C-terminal fragment (Tg34AR) as a Cro-LacI fusion protein
(27). In an ELISA detecting ROP2 IgG antibodies, a
sensitivity of 89% relative to that of the Sabin-Feldman dye test was
obtained. To find an antigen which could complement Tg34AR in serology,
a targeted cDNA library screening was performed, yielding the GRA7
antigen as recently reported (9). Here we describe the
performance of GRA7 for application in serology, alone and in
combination with Tg34AR. B-cell epitope analysis was used to define
the most important antigenic regions of this protein.
 |
MATERIALS AND METHODS |
Reagents, sera, and monoclonal antibodies (MAbs).
All
reagents were of analytical grade and were obtained from Merck
(Darmstadt, Germany), Sigma (St. Louis, Mo.), or Bio-Rad Laboratories
(Richmond, Calif.). Restriction enzymes and DNA-modifying enzymes were
purchased from Boehringer Mannheim (Brussels, Belgium) and were used in
accordance with the manufacturer's instructions. Protein
concentrations were determined by the bicinchoninic acid method
(Pierce, Rockford, Ill.).
Serum samples were obtained from patients during routine screening for
toxoplasmosis. A first set of 95 positive and 48 negative serum samples
was tested by immunofluorescence (IF) (Toxo-Spot IF; bioMérieux
Benelux, Brussels, Belgium) as well as with an ELISA (Toxo IgG Micro
EIA2; bioMérieux Benelux). Discrepant results were confirmed by
the Sabin-Feldman dye test. A second set of 192 positive and 94 negative serum samples was tested only by IF. Results discrepant with
those of the GRA7 ELISA were checked by the bioMérieux ELISA. A
third set consisted of 67 serum samples determined to be IgM positive
by IF (titers between 1/50 and 1/800).
MAb BATO 214 directed to GRA7 (24) was obtained from ascites
fluid. A MAb directed to an epitope in the mouse tumor necrosis factor (mTNF) leader peptide was also available and was purified from
culture supernatant.
Plasmid constructions.
Molecular biology methods such as
digestions with restriction enzymes, blunting with T4 DNA polymerase,
ligations of DNA fragments, and transformation of E. coli
with plasmids were all carried out as described previously
(13). Purification of DNA fragments after agarose gel
electrophoresis was performed with the Geneclean II kit (Bio 101, La
Jolla, Calif.).
(i) Vectors pmTNFMPH and pIGFH111.
The vector pmTNFMPH
enabled expression of recombinant proteins as N-terminal fusions with a
short (25 residues) mTNF peptide followed by six consecutive histidine
residues (6). The mTNF peptide contained an antigenic
epitope for which a specific MAb is available. The polyhistidine
allowed purification using immobilized metal affinity chromatography
(8). Transcription of heterologous genes cloned in this
vector was initiated by the early leftward lambda promoter (Pl), which
was controlled by the C1 repressor. The host cell used for expression
was E. coli MC1061(pAC1), containing a compatible
plasmid which carries the C1-857 mutant gene, which encodes
a temperature-sensitive variant of the C1 repressor (22). This allowed the initiation of expression of heterologous genes by
shifting the temperature of the culture from 28 to 42°C.
Vector pIGFH111 was a derivative of pmTNFMPH containing the
bacteriophage T7 gene 10 fragment (E-enhancer) that stimulated
expression of genes due to enhanced translation efficiency (
19,
20). A double-stranded synthetic oligonucleotide
(CCCAATTTTGTTTAACTTTAA)
was inserted into a
KpnI-blunted site downstream from the lambda
Pl promoter.
Variations in expression levels of GRA7 fragments,
caused by the
E-enhancer, were not examined in the present study.
Leader peptide
sequences and polylinkers were identical in both
vectors.
(ii) Construction of expression plasmids.
Plasmid
pmTNFMPHTg20 expressing the gra7 gene has been described
before (9). Three truncated fragments of Tg20 were obtained by digesting pmTNFMPHTg20 with BamHI and Asp700,
BamHI and NaeI, or BamHI and
StyI (StyI blunted). The BamHI site
was part of the polylinker and situated just upstream from the
N-terminal end of Tg20, while Asp700, NaeI, and
StyI were internal sites of the Tg20 gene (see Fig. 1).
Vector pIGFH111 was digested with BamHI and StuI,
the latter generating blunt ends. This construction design enabled
cloning of the BamHI-blunt fragments in the BamHI and StuI ends of the vector. In all four expression
plasmids, the leader peptides were exactly the same length. By removing 3' fragments from Tg20, the stop codon was also removed. However, vector pIGFH111 contains a stop codon in each reading frame downstream from the polylinker. The recombinant proteins GRA7BA, GRA7BN, and
GRA7BS contain 1, 2, and 12 foreign amino acids respectively, at the
C-terminal end, due to read-through into the vector sequence.
(iii) Expression of recombinant protein.
Plasmids were
transformed into strain MC1061(pAC1). A small-scale induction
(shift from 28 to 42°C) was carried out on a 15-ml culture at a cell
optical density at 600 nm (OD600) of 0.2. Samples were
taken 1, 2, and 3 h after induction. Total cell lysates were loaded on sodium dodecyl sulfate (SDS)-polyacrylamide gels and transferred to nitrocellulose membranes. When the optimal induction conditions were determined, a large-scale fermentation (15 liters) was
carried out.
Purification of recombinant antigens.
Small-scale
purifications were carried out with Ni-nitrilotriacetic acid spin
columns (Qiagen, Hilden, Germany) by using a slightly modified method.
Cells from a 25-ml culture that was induced for 3 h at 42°C were
harvested by centrifugation. The cell pellet was lysed by shaking for
30 min in 50 mM phosphate buffer (pH 8.3) containing 6 M guanidine HCl.
The lysate was cleared by centrifugation (10 min, 18,000 × g). The spin column was equilibrated with the same buffer,
and the sample was loaded (600 µl). The column was sequentially
washed two times with 6 M guanidine HCl-50 mM phosphate buffer (pH
6.3) and eluted with 6 M guanidine HCl-50 mM phosphate buffer at pH
4.3. Fifty microliters from the purified protein solution was
supplemented with 3 volumes of methanol to precipitate the protein for
analysis by polyacrylamide gel electrophoresis (PAGE) and Western
blotting (WB).
For large-scale purifications, bacteria from an induced culture (3.75 liters from a 15-liter fermentor vessel) were harvested
by
centrifugation. The cell pellet was resuspended in lysis buffer
(100 mM
KCl, 10 mM Tris HCl [pH 6.8], 5 mM EDTA, 20 mM

-aminocaproic
acid,
1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride)
and passed
three times through a French press. The lysate was
centrifuged to
obtain a pellet containing the recombinant protein;
this pellet was
extracted with 8 M guanidine HCl-50 mM phosphate
buffer (pH 7.2) and
homogenized (Polytron PT1200; Kinematica AG,
Litau, Switzerland). A
column containing 10 ml of chelating Sepharose
Fast Flow (Pharmacia,
Uppsala, Sweden) was activated with NiCl
2 and washed with 6 M guanidine HCl-50 mM phosphate buffer (pH 7.2)
as described by the
manufacturer. The extract was then loaded
onto the column, and elution
was carried out with an imidazole
step gradient (35, 50, 200 mM
imidazole) in the same buffer. By
using this procedure, the fusion
protein was purified to 98% homogeneity
as determined by gel
electrophoresis, silver staining, and WB.
Antigen Tg34AR and fragment
GRA7BN were purified by the same
procedure.
Gel electrophoresis and WB.
The total E. coli
extracts or purified recombinant proteins were analyzed by SDS-12%
PAGE in the presence of
-mercaptoethanol. When necessary, proteins
were transferred to nitrocellulose membranes by the wet WB technique in
carbonate buffer (10 mM NaHCO3, 3 mM Na2CO3, 20% [vol/vol] methanol)
(4).
The membrane was saturated with 5% fat-free milk in 10 mM Tris-150 mM
NaCl-0.05% Tween 20 (TNT) for 1 h, followed by two washes
in
TNT. The membranes were incubated for 90 min with MAbs, appropriately
diluted in TNT containing 1% bovine serum albumin. For screening
purposes, sera were preadsorbed on ice for 30 min by using 10%
E. coli lysate (protein concentration, 16 mg/ml) in the
dilution
buffer (TNT plus 1% bovine serum albumin). After three washes
with TNT, the bands were revealed with rabbit anti-mouse IgG conjugate
(Dako, Glostrup, Denmark) or rabbit anti-human IgG alkaline
phosphatase-labelled
conjugate (Dako). Conjugates were diluted 1/2,000.
Alkaline phosphatase
activity was detected by using the chromogenic
substrate nitroblue
tetrazolium-5-bromo-4-chloro-3-indolylphosphate
(NBT-BCIP) in
50 mM Tris HCl (pH 9.5)-150 mM NaCl-5 mM
MgCl
2 buffer (
3).
Prestained protein markers (New England Biolabs, Beverly, Mass.) were
used for both SDS-PAGE and WB (maltose-binding
protein-

-galactosidase,
175 kDa; maltose-binding
protein-paramyosin, 83 kDa; glutamic
dehydrogenase, 62 kDa; aldolase,
47.5 kDa; triosephosphate isomerase,
32.5 kDa;

-lactoglobulin A, 25 kDa; lysozyme, 16.5 kDa; aprotinin,
6.5
kDa).
Synthesis of peptides.
The peptides were synthesized on
Tentagel S resin (Rapp Polymere GmbH, Tubingen, Germany) by using a
Rainin Symphony Multiplex synthesizer (Protein Technologies, Tucson,
Ariz.) with standard 9-fluorenylmethoxycarbonyl (Fmoc) chemistry.
Standard double couplings were performed by using a fourfold excess of
Fmoc-protected amino acids activated in situ with equimolar amounts of
N-hydroxybenzotriazole and
2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium tetrafluoroborate twice for 20 min each time. The Fmoc protecting group was removed by
using a mild base treatment with 2% piperidine-2%
1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in dimethyl formamide.
N-terminal biotinylation was performed by dissolving biotin in 30%
dimethyl sulfoxide-70% dimethyl formamide with in situ activation.
After completion of the peptide synthesis, the peptide was cleaved from
the resin by incubation for 2.5 h with 90% trifluoroacetic
acid-5% thioanisole-3% ethanedithiol-2% anisole. The peptide was
precipitated from the mixture by using
t-butyl methyl ether.
After
centrifugation, the pellet was washed three times with
t-butyl
methyl ether and dried overnight in a vacuum. The
purity of the
crude peptide was checked by reversed-phase
high-performance liquid
chromatography.
ELISA.
ELISA plates (Immuno Plate Maxisorp F96; Nunc,
Roskilde, Denmark) were coated with 100-µl of 50 mM carbonate buffer
(pH 9.6)/well, containing 2 µg of GRA7 per ml or 6 µg of Tg34AR per
ml, by incubation at 37°C for 1 h. When GRA7 and Tg34AR were
used in combination, 1 and 6 µg/ml, respectively, were used to coat
the ELISA plates. Blocking of the solid phase was carried out by
incubation at 37°C for 1 h with phosphate-buffered saline (PBS)
containing 0.1% casein and 0.1% Kathon CG (Haas and Rohm Benelux,
Antwerp, Belgium) as a preservative (300 µl/well). After the wells
were emptied, 100 µl of human serum diluted at 1/100 was added to the
wells (sample diluent was PBS, 0.1% casein, 0.1% Kathon CG, and
2.86 g of Triton X-705 per liter). Serum incubation was continued
for 1 h at 37°C. After three washes with PBS plus 0.05% Tween
20, goat anti-human IgG-Fc conjugated to horseradish peroxidase (BRL,
Gaithersburg, Md.) diluted 1/30,000 in blocking buffer was added and
incubation was continued for 1 h at 37°C (100 µl/well). After
three washes, the peroxidase activity was detected with
H2O2 and 3,3',5,5'-tetramethylbenzidine for 30 min at room temperature. The reaction was stopped with 1 N
H2SO4, and the OD450 was read
(Bio-Tek Instruments, Winooski, Vt.).
When the antigens used for coating were of lower purity (<96%), 5%
E. coli lysate was added to the sample diluent.
E. coli lysate was prepared from strain MC1061(pACI) (protein
concentration,
16 mg/ml).
For use in the ELISA, MAb BATO 214 ascites fluid was diluted 1/100,000
and the anti-mTNF MAb was diluted 1/5,000. The conjugate
used was
labelled with rabbit anti-mouse immunoglobulin-horseradish
peroxidase (Dako), diluted 1/2,000. In ELISAs using biotinylated
peptides as antigen, the plates were coated with 5 µg of streptavidin
(Boehringer Mannheim) per ml in carbonate buffer (1 h, 37°C) and
subsequently incubated with the peptides at 1 µg/ml (1 h, 37°C).
Further processing was as described above. Peptides 1, 4, and
5 were
dissolved in 0.1% trifluoroacetic acid in water at a concentration
of
5 mg/ml; peptides 2 and 3 were dissolved in 0.1% TFA-20%
acetonitrile
in water at 4 mg/ml.
 |
RESULTS |
Recombinant expression of GRA7 and GRA7 fragments.
The
gra7 insert (Tg20) was transferred from pBKS(+)Tg20 to
the expression vector pmTNFMPH as described previously (9). The fusion protein resulting from expression plasmid
pmTNFMPHTg20 contained 272 amino acids, 37 residues of
which were provided by the leader peptide. The calculated
molecular mass of this recombinant GRA7 protein was 29,846 Da.
Three truncated fragments of
gra7 were generated by using
internal restriction sites:
Asp700 at position 290,
NaeI at position
437, and
StyI at position 588 (Fig.
1). All three fragments were
cloned into expression vector pIGFH111 to give rise to plasmids
pIGFH111GRA7BA, pIGFH111GRA7BN, and pIGFH111GRA7BS. Exactly the
same leader peptide is encoded by the four plasmids.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of recombinant GRA7 and GRA7
fragments produced in E. coli. The mTNF portion (open bar),
the His6 tag (black bar), and the GRA7 portion (grey bar)
are indicated. The amino acids present in the recombinant GRA7
fragments are indicated, relative to the initiator methionine.
|
|
The four expression constructs were each transformed into
E. coli MC1061(pAC1) and induced. The highest expression level
was
obtained after 3 h of induction for all four expression
products
(data not shown). The expression level was highest for GRA7
and
GRA7BA and lower for GRA7BN and for GRA7BS, as determined on WB
with anti-mTNF MAb detection (Fig.
2A).
For GRA7BN, the expression
level at 28°C was nearly equal to that of
the induced culture.
The apparent sizes of GRA7 and the truncated
fragments as determined
on WB

18 kDa for GRA7BA, 25 kDa for
GRA7BN, 31 kDa for GRA7BS,
and 36 kDa for GRA7

are larger than
the calculated sizes of 14.5,
20, 25, and 30 kDa, respectively.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 2.
WB of E. coli lysate expressing recombinant
GRA7 or recombinant GRA7 fragments. Lanes 2, 4, 6, 8, and 10, lysates
of noninduced cultures; lanes 3, 5, 7, 9, and 11, lysates of induced
cultures. Lane 1, protein marker; lanes 2 and 3, leader peptider only;
lanes 4 and 5, GRA7; lanes 6 and 7, GRA7BS; lanes 8 and 9, GRA7BN;
lanes 10 and 11, GRA7BA. (A) Reaction with anti-mTNF MAb; (B) reaction
with MAb BATO 214.
|
|
Purification of recombinant proteins.
Recombinant proteins
GRA7BN and GRA7BA were purified by using the Ni-nitrilotriacetic acid
spin columns. The protein concentration for purified GRA7BN was 180 µg/ml, and that for GRA7BA was 265 µg/ml. The purified proteins
still contained some E. coli contaminants, based on WB
developed with anti-E. coli serum, but were considered to be
of sufficient purity for a first evaluation. Antigen fragment GRA7BS
was not purified due to its lower expression level.
From a larger-scale purification of fragment GRA7BN, 0.46 mg/liter of
fermentor broth was obtained at 95% purity. The large-scale
purification of GRA7 and Tg34AR yielded 7.5 and 13.5 mg per liter
of
fermentor broth, respectively. In both cases, a purity of at
least 98%
was
obtained.
IgG ELISA with recombinant GRA7.
To determine the optimal
coating conditions for the GRA7 antigen, different coating
concentrations and coating buffers were tested. The GRA7 antigen at a
concentration of 2 µg/ml in 50 mM carbonate buffer (pH 9.6) was found
to be optimal for coating. The first set of samples, composed of 95 IgG-positive and 48 IgG-negative serum samples, was tested as described
in Materials and Methods (Fig. 3A). The
cut-off was determined by calculating the mean value for the 48 negative serum samples and adding three standard deviations. One
negative serum sample scored above the cut-off (no. 244, OD
0.309), resulting in a specificity of 98%. Of 95 positive serum
samples, 77 were detected, resulting in a sensitivity of 81%.
The 10 serum samples included in the 95 positive serum samples that
were both IgM and IgG positive were all detected. For the chronic-phase
serum samples (IgG positive only), the sensitivity was 79% (67 of 85 serum samples). When ranked by IF titer, high-titer serum samples
(titer of 1/1,024 or higher) were all detected (sensitivity, 100%),
whereas serum samples with IF titers of 1/256 or 1/64 were less
reactive (83 and 65% sensitivities, respectively) (Table 1). Results obtained with the second set
of serum samples confirmed the data from the first evaluation with a
sensitivity of 80% (154 of 192 serum samples detected) and a
specificity of 98% (2 false positives out of 94 serum samples).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
ELISA reactivity of two different sets of serum samples.
The cut-off value is indicated for each experiment by a horizontal
line. (A) Detection of a set of 95 IgG-positive ( ) and 48 IgG-negative ( ) human serum samples with the recombinant antigens
GRA7, Tg34AR, and a combination of both; (B) detection of a set of 67 IgM-positive ( ) and 25 IgM- and IgG-negative ( ) human serum
samples with the recombinant antigens GRA7 and Tg34AR.
|
|
To further substantiate the results with IgM-positive sera (acute-phase
sera), the GRA7 ELISA was carried out with an additional
set of 67 IgM-positive serum samples, resulting in a sensitivity
of 94% (cut-off
calculated with 25 IgM- and IgG-negative serum
samples) (Fig.
3B). The
OD values of serum samples with IF IgM
titers of 1/400 and 1/800 were
very high in the latter
experiment.
IgG ELISA with Tg34AR and with combined antigens.
When Tg34AR was tested for the first set of serum samples as described
above, a sensitivity of 88% and a specificity of 100% were
demonstrated. Some serum samples that were nonreactive with Tg34AR were reactive with GRA7 and vice versa (Table
2), indicating that the two antigens in
combination could increase the sensitivity of the test.
When both GRA7 and Tg34AR were coated onto the ELISA plates
simultaneously, the optimal sensitivity was obtained when GRA7
was used
at 1 µg/ml and Tg34AR was used at 6 µg/ml in carbonate
buffer (pH
9.6).
Under these conditions, one negative serum sample scored positive
(specificity, 98%) with a cut-off value of 0.134. Of the
positive
serum samples, 91 of 95 reacted positively, bringing
the sensitivity to
96% (Fig.
3A). Four serum samples continued
to score close to the
cut-off, which adversely affected the clear
separation between positive
and negative serum samples. Just as
for GRA7, the relationship between
the IF titer and the sensitivity
was analyzed for Tg34AR and for the
antigen combination (Table
1). Serum samples with an IF titer of
1/1,024 or higher were
all detected by both ELISAs. Serum samples with
an IF titer of
1/256 were detected with a sensitivity of 96%, whereas
serum samples
with an IF titer of 1/64 were detected with 93%
sensitivity when
the antigen combination was
used.
In contrast to the ELISA with GRA7, the ELISA with Tg34AR
with the set of IgM-positive sera detected only 85% of the serum
samples (Fig.
3B). Of 10 serum samples not detected by the Tg34AR
ELISA, 8 were positive for GRA7. Most serum samples scored higher
with
GRA7. In particular, those serum samples with high IgM titers,
indicative of an early infectious stage, were more easily detected
with
GRA7 (Table
3). This suggests an earlier
IgG antibody response
to GRA7 than to Tg34AR.
Localization of the epitope for BATO 214.
On WB, MAb BATO
214 reacted with GRA7, GRA7BS, and GRA7BN but not with GRA7BA, the
shortest fragment (Fig. 2B). This result was confirmed with an ELISA in
which GRA7, GRA7BA, or GRA7BN was coated onto plates and detected with
MAb BATO 214 (Table 4). GRA7BA did not
react, while full-size GRA7 and GRA7BN were recognized. This indicated
that the shortest GRA7 fragment lacked the epitope for BATO 214 while GRA7BN still contained it. The protein fragment containing the
epitope was thus expected to be situated between residue 97 and
residue 146, in case a linear epitope was involved. Five
biotinylated synthetic peptides of 20 residues and one peptide of 16 residues, each with an overlap of 10 residues, were synthesized starting with residue 91 and ending with residue 146. All peptides were
tested in an ELISA as described in Materials and Methods. The first two
peptides reacted with the MAb (Table 4), narrowing down the epitopic
determinant to the overlap region of both peptides (RKRGVRSDAE).
Determination of the epitopic region of GRA7 for human IgG.
Recombinant purified antigen fragments GRA7BA and GRA7BN and full-size
GRA7 were evaluated in an ELISA with 32 GRA7-positive human serum samples.
Of all the GRA7-positive serum samples tested, none was reactive with
fragment GRA7BA, indicating that this fragment probably
contains no
dominant human B-cell epitopes. When compared to complete
GRA7,
GRA7BN displayed an equal or slightly reduced reactivity
of up to 20%
in 12 of the 32 serum samples tested (Fig.
4). A
30 to 50% reduction of reactivity
was observed in 17 of 32 serum
samples, while for 3 of 32 serum samples
the reduction was >50%
(two of which showed no reactivity with
GRA7BN). This finding
indicates that an important antigenic region of
GRA7 is situated
between residues 97 and 146. It seems that for the
serum samples
that were unreactive with GRA7BN, an epitope is
present in the
deleted part of GRA7 or that this fragment is at least
needed
to preserve the structure of the epitope. In contrast to
GRA2
and GRA4 (
16,
17), the major hydrophilic domain in the
C-terminal
region of GRA7 (results not shown) seems not to contain an
important
epitope.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 4.
ELISA reactivity of 32 GRA7-positive serum samples with
complete GRA7, with GRA7BN, and with GRA7BA.
|
|
The sera were also subsequently tested with the five synthetic
peptides mentioned above. Most sera showed a weak reaction
with several
peptides, while others failed to react at all (data
not shown). The
analysis of the peptide reactivity did not allow
further elucidation of
the epitope recognized by the human
sera.
 |
DISCUSSION |
Recently, a new dense granule protein (GRA7) from T. gondii was described, and the corresponding gene was characterized
(9). To study the potential of this protein for serological
assays, the gra7 gene was expressed in E. coli
with a short mTNF fragment and hexahistidine as a fusion partner. The
subsequent purification of the recombinant protein allowed evaluation
of this antigen as a diagnostic tool. In an indirect IgG ELISA, a
sensitivity of 81% and a specificity of 98% were reached. High-titer
IgG-positive sera (IF titer, >1/1,024) were readily detected (100%).
IgM-positive sera were detected in 94% of cases, and for chronic-phase
sera (IgM negative) the sensitivity was 79%. In general,
chronic-stage sera with low IgG titers by IF were more difficult
to detect with GRA7. These results were in the same range as those
obtained for a recombinant fragment of GRA2 (75% for chronic-phase
sera, 82.6% for acute-phase sera) (17) and for Tg34AR (ROP2
fragment; 89% overall sensitivity) (27). The combination of
H4 and H11 detected 64% of acute-phase sera and 14% of chronic-phase
sera (26).
The facts that IgM-positive sera were detected with high sensitivity
and that especially high-titer IgM-positive sera (IgM titers by IF,
1/400 and 1/800) reached high OD values seem to contradict the
findings of Fisher et al. (5), who found that GRA7 is
released from bradyzoite-infected host cells (chronic phase) and
not from tachyzoite-infected host cells (acute phase). If GRA7 is
secreted from bradyzoites, a strong antibody response to this antigen
would be expected in sera from chronic patients. Unexpectedly, we
observed a low antibody response in these patients. On the other hand,
in sera from patients with acute infections, a strong antibody response
was found. This contradiction between in vitro and in vivo results
needs further investigation. It is possible that bradyzoites studied in
vitro behave differently from those found in cysts upon encapsidation
of the parasite in the organs of infected patients. The fact that GRA7
was found in the parasitophorous vacuole (PV), the PV membrane, and the cytoplasm of the host cell infected with the tachyzoite stage (9) is in agreement with these ELISA results, where high
reactivity with sera from acute-stage infections is found. In the
acute stage, constant rupture of infected cells releases the contents
of the PV and the cytoplasm and thus brings GRA7 in contact with the immune system. It would be interesting to compare the GRA7 response to
that of other GRA antigens, especially GRA3, which has also been shown
to be present in the host cell cytoplasm (2).
Remarkably, Tg34AR failed to detect several high-titer
IgM-positive sera while they clearly scored positive when
GRA7 was used. It is expected that both antigens become exposed to the immune system at the moment of cell rupture and, hence, provoke an
immune response from the same moment on. However, this seems not to
occur, and the immune response towards these two antigens varies
considerably. In part, these differences may be attributed to the
intrinsic antigenic properties of the proteins. Further research is
needed to clarify these findings.
The combination of GRA7 with Tg34AR could detect 96% of IgG-positive
sera. Both antigens complement each other in the detection of some
sera, but both fail to detect some chronic-phase sera with low titers.
Possibly, a bradyzoite-specific antigen could be used to detect those
sera and, hence, complement GRA7 and/or Tg34AR.
The study of GRA7 fragments and peptides allowed the localization of
the epitope for the anti-GRA7 MAb BATO 214. However, this
epitope was not found to be immunodominant when human sera were
studied. In humans, the fragment comprising amino acids 97 to 146 is
the most important antigenic region of GRA7. The major epitope
recognized by human sera could not be further mapped by synthetic
peptides, in contrast to the mouse monoclonal epitope. This may
partly be attributed to the polyclonal nature of the antibody response
generated upon infection. However, the fact that no clear reactivity
with any of the peptides from the antigenic region is defined may
indicate that peptides of 20 amino acids as used here are unable to
form the relevant epitope. This observation leads us to assume that
the major epitope recognized by human sera in this region has an
important structural component. Only some sera recognize an
epitope(s) beyond amino acid 146, which is not unexpected since
this is the region downstream from the putative membrane anchor.
However, this finding contrasts with the observations made for GRA2 and
GRA4, where a major antigenic domain was found in the region
comprising the C-terminal 50 amino acids (16, 17). Despite
the more pronounced hydrophilic nature of the C terminus of GRA7 as
compared to that of GRA2 and GRA4, this region is less antigenic in the
GRA7 protein.
In conclusion, we have shown that the newly discovered GRA7 protein may
be considered as an additional tool for studying the immune response of
humans to T. gondii. On the other hand, additional questions have been raised concerning the role of this antigen in the
infectious process. The tools which are now available as a consequence
of the work described here will allow further extension of these studies.
 |
ACKNOWLEDGMENTS |
We thank I. Rockelé and G. Clemminck for protein
purification, B. Van Der Perre for peptide synthesis, and F. Shapiro for editorial comments.
This work was partially funded by the Flemish IWT, grant no. 970013.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Innogenetics
N.V., Industriepark Zwijnaarde 7, B-9052 Gent, Belgium. Phone:
32-9-2410803. Fax: 32-9-2410907. E-mail:
dirkjac{at}innogenetics.be.
 |
REFERENCES |
| 1.
|
Beckers, C. J.,
J.-F. Dubremetz,
O. Mercereau-Puijalon, and K. A. Joiner.
1994.
The Toxoplasma gondii rhoptry protein ROP 2 is inserted into the parasitophorous vacuole membrane, surrounding the intracellular parasite, and is exposed to the host cell cytoplasm.
J. Cell Biol.
127:947-961[Abstract/Free Full Text].
|
| 2.
|
Bermudes, D.,
J.-F. Dubremetz,
A. Achbarou, and K. A. Joiner.
1994.
Cloning of a cDNA encoding the dense granule protein GRA3 from Toxoplasma gondii.
Mol. Biochem. Parasitol.
68:247-257[Medline].
|
| 3.
|
Blake, M. S.,
K. H. Johnson,
G. J. Russell-Jones, and E. C. Gotschlich.
1984.
A rapid, sensitive method for detection of alkaline phosphatase-conjugated anti-antibody on Western blots.
Anal. Biochem.
136:175-179[Medline].
|
| 4.
|
Dunn, S. D.
1986.
Effects of the modification of transfer buffer composition and the renaturation of proteins in gels on the recognition of proteins on Western blots by monoclonal antibodies.
Anal. Biochem.
157:144-153[Medline].
|
| 5.
|
Fisher, H.-G.,
S. Stachelhaus,
M. Sahm,
H. E. Meyer, and G. Reichman.
1998.
GRA7, an excretory 29 kDa Toxoplasma gondii dense granule antigen released by infected host cells.
Mol. Biochem. Parasitol.
91:251-262[Medline].
|
| 6.
|
Gilot, P.,
M. De Kesel,
L. Machtelinckx,
M. Coene, and C. Cocito.
1993.
Isolation and sequencing of the gene coding for an antigenic 34-kilodalton protein of Mycobacterium paratuberculosis.
J. Bacteriol.
175:4930-4935[Abstract/Free Full Text].
|
| 7.
|
Harning, D.,
J. Spenter,
A. Metsis,
J. Vuust, and E. Petersen.
1996.
Recombinant Toxoplasma gondii surface antigen 1 (P30) expressed in Escherichia coli is recognized by human Toxoplasma-specific immunoglobulin M (IgM) and IgG antibodies.
Clin. Diagn. Lab. Immunol.
3:355-357[Abstract].
|
| 8.
|
Hochuli, E.,
H. Bannwarth,
R. Doebeli,
R. Gentz, and D. Stueber.
1988.
Genetic approach to facilitate purification of recombinant proteins with a novel metal chelate adsorbent.
Biotechnology
6:1321-1325.
|
| 9.
|
Jacobs, D.,
J.-F. Dubremetz,
A. Loyens,
F. Bosman, and E. Saman.
1998.
Identification and heterologous expression of a new dense granule protein (GRA7) from Toxoplasma gondii.
Mol. Biochem. Parasitol.
91:237-249[Medline].
|
| 10.
|
Johnson, A. M., and S. Illana.
1991.
Cloning of Toxoplasma gondii gene fragments encoding diagnostic antigens.
Gene
99:127-132[Medline].
|
| 11.
|
Kim, K.,
R. Bulow,
J. Kampmeier, and J. C. Boothroyd.
1994.
Conformationally appropriate expression of the toxoplasma antigen SAG1 (P30) in CHO cells.
Infect. Immun.
62:203-209[Abstract/Free Full Text].
|
| 12.
|
Luft, B. J.,
R. G. Brooks,
F. K. Conley,
R. E. McCabe, and J. S. Remington.
1984.
Toxoplasma encephalitis in patients with AIDS.
JAMA
252:913-917[Abstract/Free Full Text].
|
| 13.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 14.
|
Mercier, C.,
L. Lecordier,
F. Darcy,
D. Deslee,
A. Murray,
B. Tourvieille,
P. Maes,
A. Capron, and M.-F. Cesbron-Delauw.
1993.
Molecular characterisation of a dense granule antigen (GRA 2) associated with the network of the parasitophorous vacuole in Toxoplasma gondii.
Mol. Biochem. Parasitol.
58:71-82[Medline].
|
| 15.
|
Mevelec, M.-N.,
T. Chardes,
O. Mercereau-Puijalon,
I. Bourgin,
A. Achbarou,
J.-F. Dubremetz, and D. Bout.
1992.
Molecular cloning of GRA4, a Toxoplasma gondii dense granule protein, recognized by mucosal IgA antibodies.
Mol. Biochem. Parasitol.
56:227-238[Medline].
|
| 16.
|
Mevelec, M.-N.,
O. Mercereau-Puijalon,
D. Buzoni-Gatel,
I. Bourguin,
T. Chardès,
J.-F. Dubremetz, and D. Bout.
1998.
Mapping of B epitopes in GRA4, a dense granule antigen of Toxoplasma gondii and protection studies using recombinant proteins administered by the oral route.
Parasite Immunol.
20:183-195[Medline].
|
| 17.
|
Murray, A.,
C. Mercier,
A. Decoster,
L. Lecordier,
A. Capron, and M.-F. Cesbron-Delauw.
1993.
Multiple B-cell epitopes in a recombinant GRA2 secreted antigen of Toxoplasma gondii.
Appl. Parasitol.
34:235-244[Medline].
|
| 18.
|
Nam, H.-W.,
K.-S. Im,
E.-J. Baek,
W.-Y. Choi, and S.-Y. Cho.
1996.
Analysis of antigenic domain of GST fused major surface protein (P30) fragments of Toxoplasma gondii.
Korean J. Parasitol.
34:135-141[Medline].
|
| 19.
|
Olins, P. O.,
C. S. Devine,
S. H. Rangwala, and K. S. Kavka.
1988.
The T7 phage gene 10 leader RNA, a ribosome-binding site that dramatically enhances the expression of foreign genes in Escherichia coli.
Gene
73:227-235[Medline].
|
| 20.
|
Olins, P. O., and S. H. Rangwala.
1989.
A novel sequence element derived from bacteriophage T7 mRNA acts as an enhancer of translation of the lacZ gene in Escherichia coli.
J. Biol. Chem.
264:16973-16976[Abstract/Free Full Text].
|
| 21.
|
Parmley, S. F.,
G. D. Sgarlato,
J. Mark,
J. B. Prince, and J. S. Remington.
1992.
Expression, characterisation, and serologic reactivity of recombinant surface antigen P22 of Toxoplasma gondii.
J. Clin. Microbiol.
30:1127-1133[Abstract/Free Full Text].
|
| 22.
|
Remaut, E.,
H. Tsao, and W. Fiers.
1983.
Improved plasmid vectors with a thermoinducible expression and temperature-regulated runaway replication.
Gene
22:103-113[Medline].
|
| 23.
|
Remington, J. S., and G. Desmonts.
1990.
Toxoplasmosis, p. 89-195.
In
J. S. Remington, and J. O. Klein (ed.), Infectious diseases of the fetus and newborn infant, 2nd ed. The W. B. Saunders Co., Philadelphia, Pa.
|
| 24.
|
Saavedra, R.,
F. De Meuter, and P. Hérion.
1990.
Monoclonal antigens identify new Toxoplasma gondii soluble antigens.
Hybridoma
9:453-463[Medline].
|
| 25.
|
Saavedra, R.,
F. De Meuter,
J. L. Decourt, and P. Hérion.
1991.
T-cell clone identifies a potentially protective 54 kDa protein antigen of Toxoplasma gondii cloned and expressed in Escherichia coli.
J. Immunol.
147:1975-1982[Abstract].
|
| 26.
|
Tenter, A. M., and A. M. Johnson.
1991.
Recognition of recombinant Toxoplasma gondii antigens by human sera in an ELISA.
Parasitol. Res.
77:197-203[Medline].
|
| 27.
|
Van Gelder, P.,
F. Bosman,
F. De Meuter,
H. Van Heuverswyn, and P. Hérion.
1993.
Serodiagnosis of toxoplasmosis by using a recombinant form of the 54-kilodalton rhoptry antigen expressed in Escherichia coli.
J. Clin. Microbiol.
31:9-15[Abstract/Free Full Text].
|
| 28.
|
Velge-Roussel, F.,
T. Chardès,
P. Mévélec,
M. Brillard,
J. Hoebeke, and D. Bout.
1994.
Epitopic analysis of the Toxoplasma gondii major surface antigen SAG1.
Mol. Biochem. Parasitol.
66:31-38[Medline].
|
| 29.
|
Xiong, C.,
R. B. Grieve,
K. Kim, and J. C. Boothroyd.
1993.
Expression of Toxoplasma gondii P30 as fusions with glutathione S-transferase in animal cells by Sindbis recombinant virus.
Mol. Biochem. Parasitol.
61:143-148[Medline].
|
Clinical and Diagnostic Laboratory Immunology, January 1999, p. 24-29, Vol. 6, No. 1
1071-412X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Buffolano, W., Beghetto, E., Del Pezzo, M., Spadoni, A., Di Cristina, M., Petersen, E., Gargano, N.
(2005). Use of Recombinant Antigens for Early Postnatal Diagnosis of Congenital Toxoplasmosis. J. Clin. Microbiol.
43: 5916-5924
[Abstract]
[Full Text]
-
Ferrandiz, J., Mercier, C., Wallon, M., Picot, S., Cesbron-Delauw, M.-F., Peyron, F.
(2004). Limited Value of Assays Using Detection of Immunoglobulin G Antibodies to the Two Recombinant Dense Granule Antigens, GRA1 and GRA6 Nt of Toxoplasma gondii, for Distinguishing between Acute and Chronic Infections in Pregnant Women. CVI
11: 1016-1021
[Abstract]
[Full Text]
-
Pietkiewicz, H., Hiszczynska-Sawicka, E., Kur, J., Petersen, E., Nielsen, H. V., Stankiewicz, M., Andrzejewska, I., Myjak, P.
(2004). Usefulness of Toxoplasma gondii-Specific Recombinant Antigens in Serodiagnosis of Human Toxoplasmosis. J. Clin. Microbiol.
42: 1779-1781
[Abstract]
[Full Text]
-
Li, S., Galvan, G., Araujo, F. G., Suzuki, Y., Remington, J. S., Parmley, S.
(2000). Serodiagnosis of Recently Acquired Toxoplasma gondii Infection Using an Enzyme-Linked Immunosorbent Assay with a Combination of Recombinant Antigens. CVI
7: 781-787
[Abstract]
[Full Text]
-
Lecordier, L., Fourmaux, M.-P., Mercier, C., Dehecq, E., Masy, E., Cesbron-Delauw, M.-F.
(2000). Enzyme-Linked Immunosorbent Assays Using the Recombinant Dense Granule Antigens GRA6 and GRA1 of Toxoplasma gondii for Detection of Immunoglobulin G Antibodies. CVI
7: 607-611
[Abstract]
[Full Text]
-
Aubert, D., Maine, G. T., Villena, I., Hunt, J. C., Howard, L., Sheu, M., Brojanac, S., Chovan, L. E., Nowlan, S. F., Pinon, J. M.
(2000). Recombinant Antigens To Detect Toxoplasma gondii-Specific Immunoglobulin G and Immunoglobulin M in Human Sera by Enzyme Immunoassay. J. Clin. Microbiol.
38: 1144-1150
[Abstract]
[Full Text]
-
Vercammen, M., Scorza, T., Huygen, K., De Braekeleer, J., Diet, R., Jacobs, D., Saman, E., Verschueren, H.
(2000). DNA Vaccination with Genes Encoding Toxoplasma gondii Antigens GRA1, GRA7, and ROP2 Induces Partially Protective Immunity against Lethal Challenge in Mice. Infect. Immun.
68: 38-45
[Abstract]
[Full Text]