Previous Article | Next Article ![]()
Clinical and Diagnostic Laboratory Immunology, May 1999, p. 336-340, Vol. 6, No. 3
Department of Dermatology, Okayama University
Medical School, Shikata-cho 2-5-1, Okayama 700-8558, Japan
Received 17 August 1998/Returned for modification 27 October
1998/Accepted 22 January 1999
Defensins are widely distributed and broad-spectrum antimicrobial
peptides with activities against bacteria, fungi, and enveloped viruses. Defensins have been isolated from granules of neutrophils from
humans, rabbits, rats, and guinea pigs. They have also been found in
lung macrophages as well as in Paneth cells of the human, rabbit, and
mouse small intestine. The human Antimicrobial polypeptides are
widely distributed within animal tissues and cells that frequently
encounter microorganisms (4). Some antimicrobial peptides
are stabilized by disulfide bonds, which may increase their resistance
to proteolysis or loss of conformation. Antimicrobial peptides that
contain six cysteines have been classified as defensins (7).
They are cationic, 3- to 4-kDa peptides characterized by nine highly
conserved amino acids, including six invariant cysteine residues in a
unique disulfide motif (21). They are divided into the
Mammalian defensins were first identified in phagocytic leukocytes from
humans, rabbits, guinea pigs, and rats (12). Subsequently, they were found in certain epithelial cells (3) and human
and murine Paneth cells of the small intestine (10, 18). The
defensin cryptdin is a Paneth cell corticostatin and defensin found in the mouse small bowel. The mRNA of cryptdin is one of many highly abundant mRNAs of low molecular weight that appear during postnatal intestinal development (18).
Some antimicrobial peptides have been isolated from animal and human
skin, e.g., LL-37 (5), a class of peptides known as magainins (24), and dermaseptin (15). Recently,
Preparation of tissues and cell cultures.
The strain of
BALB/c mice used in this study was purchased from the mouse colony of
Okayama University. Skin samples were taken from adult (6-week-old)
female mice, neonatal mice, and mouse embryos on embryonic days 15.5 (E15.5 mice) and 17.5 (E17.5 mice). The intestines of adult mice were
used as positive controls. For in situ hybridization, the skin samples
from E17.5, neonatal, and adult mice and the intestines of adult mice
were fixed in 4% paraformaldehyde in 0.1 M phosphate-buffered saline
at 4°C for 5 h. The fixed tissues were dehydrated through a
series of ethanol washes, immersed in xylene, and embedded in paraffin wax.
1071-412X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Detection of Cryptdin in Mouse Skin
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-defensin-2 was recently isolated
from human skin. In this study, we detected the expression of mRNA for
the defensin cryptdin in BALB/c mouse skin by means of reverse
transcriptase PCR amplification. Expression was also detected in
dispase-separated epidermis and cultured keratinocytes, but expression
was not detected in fibroblasts. The expression of cryptdin mRNA was
found to begin on embryonic day 17.5. As determined with specific
primers, the cDNA sequence cloned from the skin was found to be
identical to that previously reported for cryptdin-5. cDNA derived from
cultured keratinocytes demonstrated the sequences of the cryptdin-6 and
cryptdin-1 isoforms. In situ hybridization analysis showed that the
mRNA of cryptdin was expressed in the suprabasal keratinocytes of the
skin in embryonic and neonatal days and then shifted to the hair bulbs
in the skin of adult mice.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-defensins, the
-defensins, and the insect defensins. The three
defensin groups differ from each other in the spacing and connectivity
of their six cysteine residues (7). These peptides exhibit
broad-range activities against gram-negative and gram-positive
bacteria, many fungi, and some enveloped viruses (11, 13,
17), including the human immunodeficiency virus (16).
-defensin-2 was isolated from human skin (9). However,
defensins have not yet been reported in the skin of rodents. In this
study, we detected mRNA expression of the defensin cryptdin in the skin
of BALB/c mice using reverse transcriptase (RT) PCR (RT-PCR)
amplification and subsequent sequence analysis. We also examined the
developmental expression pattern of cryptdin mRNA in the embryonic
mouse skin and performed in situ hybridization analysis to localize cryptdin.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
RT-PCR. Total RNA from tissue samples and cultured cells was extracted with the TRIzol Reagent (Life Technologies, Gaithersburg, Md.), according to the manufacturer's instructions. RNA was reverse transcribed with Ready to go You prime First-Strand Beads (Pharmacia Biotech, Grand Island, N.Y.), according to the manufacturer's instructions. Briefly, total RNA (5 µg) from each sample was reverse transcribed with 5 µg of oligo(dT) primer.
Amplification by PCR was conducted in a 30-µl reaction volume containing 10× PCR Buffer II, 0.5 µM each primer, 1.7 mM MgCl2 solution, each deoxynucleoside triphosphate at a concentration of 0.2 mM, and 1.5 U of Taq polymerase (AmpliTaq Gold; Perkin-Elmer Corporation, Foster City, Calif.). One microliter of each cDNA mixture was used as a template. The PCR mixture was overlaid with mineral oil. Amplification of cryptdin was conducted in a thermocycler (PC-700; ASTEC, Fukuoka, Japan) with the following profiles: 95°C for 9 min (1 cycle) and 94°C for 1 min, 60°C for 1 min, and 72°C for 2 min (35 cycles). Amplification of
-actin was
conducted with the following profiles: 95°C for 9 min (1 cycle) and
94°C for 1 min, 50°C for 1 min, and 72°C for 2 min (35 cycles).
The products of PCR were analyzed by gel electrophoresis on 2% agarose gels. Amplification by PCR of cryptdin from cDNA was accomplished with primers Defcrp130
(AAGAGACTAAAACTGAGGAGCAGC) and Defcrm380 (GGTGATCATCAGACCCCAGCATCAGT) (2). The
primer Defcrp130 corresponds to nucleotides 80 to 103 in
cryptdin-1 cDNA. It is an exact match with cryptdin-1 and -4 cDNAs and
has a single mismatch at primer nucleotide 11 (A
T) with the
cryptdin-5 mRNA sequence. The primer Defcrm380 hybridizes
to the sequence 3' of the termination codon on the sense strand and
primes all known cryptdin mRNAs. Amplification by PCR of mouse
-actin from cDNA included a commercial amplimer set (CLONTECH
Laboratories, Palo Alto, Calif.) both to confirm the integrity of the
cDNA transcripts and to check for the presence of contaminating genomic DNA.
Clone construction and selection. Cryptdin PCR products were ligated directly into PCR-Script Amp SK(+) cloning vectors with a PCR-Script Amp SK(+) cloning kit (Stratagene, La Jolla, Calif.) according to the manufacturer's instructions. Constructs were transformed into Escherichia coli XL1-Blue MRF' Kan supercompetent cells (Stratagene). Transformants were selected on laked blood agar containing ampicillin (50 µg/ml).
DNA sequencing. Double-stranded plasmid DNA bearing an appropriate insert was isolated for further use as a sequencing template. Cycle sequencing was accomplished with an ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, Warrington, Great Britain), in accordance with the manufacturer's instructions. M13 universal and reverse primers were used for sequencing. Sequence homologies were determined by using the BLAST server of the National Center for Biotechnology Information.
In situ hybridization. (i) Preparation of DIG-labeled RNA probes. Digoxigenin (DIG)-11-UTP-labeled single-stranded RNA probes were prepared with the DIG RNA Labeling Kit (Boehringer Mannheim, Mannheim, Germany), according to the manufacturer's instructions. Briefly, plasmid DNA bearing cryptdin was linearized with appropriate restriction enzymes, and DIG-labeled sense and antisense probes were obtained by in vitro transcription with T3 and T7 RNA polymerases (Stratagene) together with 10× transcription buffer, a DIG-RNA labeling mixture, and an excess of RNase inhibitor (Stratagene). After digestion of the original linearized template cDNA with DNase and several ethanol precipitation steps, the probes were dissolved in water and used for hybridization.
(ii) Hybridization procedure.
In situ hybridization was
performed by the methods previously reported by Senboshi et al.
(23). Deparaffinized sections were treated with 1 µg of
proteinase K (Boehringer Mannheim) per ml, acetylated in acetic
anhydride solution, and then dehydrated. Hybridization with freshly
denatured sense or antisense RNA probes was performed in humidified
chambers at 50°C for 15 h. Sections were washed after
hybridization at 50°C under highly stringent conditions. Prior to
immunodetection of the in situ hybridization signal, the sections were
incubated in blocking solution (DIG Nucleic Acid Detection Kit;
Boehringer Mannheim). Incubation with polyclonal sheep anti-DIG Fab
fragments conjugated to alkaline phosphatase (Boehringer Mannheim) was
performed for 30 min in humidified chambers at room temperature. The
sections were stained by incubation in nitroblue tetrazolium and
-chloroindolyl phosphate solution (Boehringer Mannheim) in darkness
at room temperature. The time required for color development was
dependent on the probes used.
| |
RESULTS |
|---|
|
|
|---|
PCR amplification of cryptdin.
The amplification products of
murine small intestine, whole skin, epidermis, and keratinocyte
demonstrated the same single band of 272 bp (Fig.
1). However, the cDNA produced from
cultured fibroblasts did not yield the band, indicating that
mesenchymal cells such as fibroblasts may not be involved in cryptdin
mRNA production. An amplification product of 500 bp was also
synthesized from all cDNA templates with the
-actin primer set (Fig.
1).
|
Cryptdin gene expression in skin development.
The band
corresponding to
-actin was detected from all samples by PCR
amplification with specific primers. Cryptdin gene expression was
detected in the skin of E17.5, neonatal, and adult mice (Fig.
2). Each of these samples produced a
clear, single, 272-bp band. Those bands from samples from E17.5 and
neonatal mice were more intense than those from samples from adult
mice. No band was detected in the skin of E15.5 mice.
|
Sequence analysis.
The primer pair used amplifies
approximately half of exon 1 (nucleotides 80 to 172) and all of exon 2 of cryptdin cDNA. We performed sequence analysis in these regions of
cryptdin cDNA with PCR-Script Amp SK(+)-cloned PCR products obtained
from samples from the small intestine, whole skin, epidermis, and
keratinocytes (Fig. 3). The sequence of
cDNA derived from whole skin demonstrated nearly perfect identity with
the previously reported cryptdin-5 sequence except for a single
mismatch at cryptdin nucleotide 90 (T
A; primer nucleotide 11). The
DNA sequence amplified from the epidermis was also aligned with the
sequence of cryptdin-5. The cDNA sequences amplified from cultured
keratinocytes perfectly corresponded to exon 1 of cryptdin-6 and showed
mismatches only at cryptdin nucleotides 183 (T
G) and 200 (G
T).
The transition at position 183 resulted in a missense mutation that
changed a tyrosine codon to one for aspartic acid, and the transition
at position 200 resulted in a missense mutation that changed an
arginine codon to one for isoleucine. Another clone derived from
keratinocytes demonstrated the sequence of a cryptdin-1-like peptide,
cryptdin-11. Exon 1 of the clone correlated with that of cryptdin-1
completely, and only one substitution was found at nucleotide 237 (A
G) in codon 79, resulting in a silent mutation.
|
Developmental appearance of cryptdin mRNA in murine skin. The expression of cryptdin mRNA was clearly detected in suprabasal keratinocytes of the epidermis of the skin of E17.5 and neonatal mice when a DIG-labeled antisense cRNA probe was used (left-hand panels of Fig. 4A and B, respectively). No signal was detected in the dermis. In the skin of adult mice, the epidermis did not have a detectable signal for cryptdin, but a signal was localized to keratinocytes of the hair bulbs (left-hand panel of Fig. 4C). No signal was observed in the skin when the sense probe was used (Fig. 4A, B, and C, right-hand panels).
|
| |
DISCUSSION |
|---|
|
|
|---|
Understanding of the mechanism by which the body naturally defends
itself against bacterial invasion through the skin may lead to a new
approach to the control of bacterial infections. In this context,
defensins and similar antimicrobial peptides have become the objects of
research. Recently, defensins have been detected in Paneth cells of
human and murine intestines, in tracheal epithelial cells, as well as
in phagocytes, where it is presumed that they are involved in the
inhibition of bacterial colonization in the mucosa. The report of human
-defensin-2 expression in human keratinocytes by Harder et al.
(9) in 1997 has stimulated interest in the function of the
defensin system in the skin. Further investigation of this system
requires experimental models, but such models have yet to be reported.
The present study investigated antimicrobial peptide expression in
mouse skin by using murine Paneth cell defensin (cryptdin)-specific primers.
Amplification by RT-PCR with a cryptdin-specific primer set demonstrated the expression of cryptdin mRNA in whole skin, epidermis, and cultured keratinocytes but detected no cryptdin message in cultured fibroblasts. Our data suggest that epithelial cells are the primary source of murine skin cryptdin.
Cryptdin message expression during the development of murine skin was also examined. The intensity of the band identified with cryptdin increased drastically from embryonic day 17.5. This suggests that the expression of cryptdin in the skin may not require contact with microorganisms. Ouellette et al. (18) reported that enteric cryptdin mRNAs were equally abundant in germ-free adult mice and naturally reared adult mice. During embryonic development, murine skin differentiates rapidly: on embryonic day 14, an intermediate layer forms above the basal layer; on embryonic days 15 and 16, keratohyaline granules appear in the uppermost layer, known as the granular layer, and hair bulbs begin to form. A cornified layer forms above the granular layer on embryonic days 16 to 18. Finally, on neonatal day 2, the epidermis is fully developed and consists of four histologically distinct cell layers: the basal, spinous, granular, and cornified layers (14). The expression of cryptdin appears to correlate with the maturity and the differentiation of the skin. In an experiment with athymic nude mice, enteric defensin mRNA was found to be abundant, indicating that cellular immunity has no influence on cryptdin expression (18). The neonatal immune system is functionally immature; shortly after birth, the counts of mature T cells in the spleen are 1,000-fold lower than those in the spleens of adults (20). During the neonatal period, cryptdin may compensate for this immature immune system by acting as a biochemical shield.
Sequence analysis showed that all clones derived from the whole skin and epidermis demonstrated nearly perfect identity with cryptdin-5. This suggests that the skin of BALB/c mice primarily expresses the cryptdin-5 isoform in vivo. However, cDNA derived from cultured keratinocytes corresponded to cryptdin-6 and cryptdin-11. The sequence of cryptdin-11 that we isolated had one mismatch at position 237 in the exon 2 coding the mature peptide. Thus, it appears that keratinocytes may produce some forms of cryptdin. Darmoul et al. (1) reported that intestinal mRNAs coding for cryptdin-1-like isoforms were chiefly detected in adult mice but that cryptdin-6 was the most abundant enteric defensin mRNA in the newborn. The expression of cryptdin isoforms may be influenced by the degree of development and differentiation. More than 20 cryptdin isoform mRNAs have been found in the full-length mouse small intestine, and 17 of these cryptdin-coding mRNAs were cloned from a single jejunum crypt (19). Further examination may reveal that other forms of cryptdin are expressed by keratinocytes.
Whether the expression of cryptdin-5 is species specific or organ specific remains unclear. Compared to myeloid defensins, intestinal defensins have variably extended NH2 termini that contain from three amino acids (as in cryptdin-4) to six amino acids (as in cryptdin-5) preceding the first cysteine (22). Because such variations in defensin amino termini have been shown to correlate with relative antimicrobial potency in vitro (8), the structure of cryptdin-5 may be appropriate for the containment of bacterial colonization and invasion of the skin. When the activities of cryptdins 1 through 6 against E. coli ML35 were compared by a plate diffusion assay, cryptdin-4 and cryptdin-5 were substantially more active than the other four intestinal cryptdins (19).
In situ hybridization analysis showed that cryptdin transcripts were
expressed within the keratinocytes of the suprabasal layer from the
embryonic to the neonatal days. Fulton et al. (6) showed
that human
-defensin-1 transcripts localize within the suprabasal
keratinocytes of the skin. This pattern of cryptdin distribution
appears to be efficient for protection against pathogens from the
outside of skin with few hairs. However, in this study, we showed that
in the skin of adult mice, the mRNA of cryptdin localized to the
keratinocytes of hair bulbs. Because the body surface of most animals
is covered with hair, this localization pattern may be favorable. The
change in the distribution pattern of cryptdin in the small intestine
during development was reported by Darmoul et al. (1).
Unlike in adult mice, where only Paneth cells are immunopositive for
cryptdin, cryptdin-containing cells were distributed throughout the
developing intestinal epithelium of the newborn and not in association
with rudimentary crypts (1). These facts suggest that
cryptdin localization in the skin may change during development and differentiation.
In this study, we detected cryptdin-5 mRNA expression in mouse skin, we determined that the expression of cryptdin mRNA began between embryonic days 15.5 and 17.5, and we discovered that cryptdin transcripts were initially expressed within the keratinocytes of the suprabasal layer from the embryonic to the neonatal days and then shifted to the hair bulbs. We speculate that cryptdin-5 is a more efficient protector than any other isoform of cryptdin in limiting bacterial colonization and invasion of the skin.
| |
ACKNOWLEDGMENT |
|---|
This work was supported by Grant-in-Aid for Scientific Research 09877159 (to H.K. and T.O.) from the Ministry of Education, Science and Culture of Japan.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Dermatology, Okayama University Medical School, Shikata-cho 2-5-1, Okayama 700, Japan. Phone: 81-86-235-7282. Fax: 81-86-235-7283. E-mail: ropin{at}cc.okayama-u.ac.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Darmoul, D.,
D. Brown,
M. E. Selsted, and A. J. Ouellette.
1997.
Cryptdin gene expression in developing mouse small intestine.
Am. J. Physiol.
272:G197-G206 |
| 2. |
Darmoul, D.,
K. M. Huttner,
D. M. Frederick, and A. J. Ouelette.
1996.
Positional specificity of defensin gene expression reveals Paneth cell heterogeneity in mouse small intestine.
Am. J. Physiol.
271:G68-G74 |
| 3. |
Diamond, G.,
M. Zasloff,
H. Eck,
M. Brasseur,
W. L. Maloy, and C. L. Bevins.
1991.
Tracheal antimicrobial peptide, a novel cysteine-rich peptide from mammalian tracheal mucosa: isolation and cloning of a cDNA.
Proc. Natl. Acad. Sci. USA
88:3952-3956 |
| 4. |
Eisenhauer, P. B.,
S. S. Harwig, and R. I. Lehrer.
1992.
Cryptdins: antimicrobial defensins of the murine small intestine.
Infect. Immun.
60:3556-3565 |
| 5. |
Frohm, M.,
B. Agerberth,
G. Ahangari,
M. Stahle-Backdahl,
S. Liden,
H. Wigzell, and G. H. Gudmundsson.
1997.
The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders.
J. Biol. Chem.
272:15258-15263 |
| 6. | Fulton, C., G. M. Anderson, M. Zasloff, R. Bull, and A. J. Quinn. 1997. Expression of natural peptide antibiotics in human skin. Lancet 350:1750-1751[Medline]. |
| 7. | Ganz, T., and R. I. Lehrer. 1994. Defensins. Curr. Opin. Immunol. 6:584-589[Medline]. |
| 8. | Ganz, T., M. E. Selsted, D. Szklarek, S. S. Harwig, K. Daher, D. F. Bainton, and R. I. Lehrer. 1985. Defensins: natural peptide antibiotics of human neutrophils. J. Clin. Invest. 76:1427-1435. |
| 9. | Harder, J., J. Bartels, E. Christophers, and J. M. Schroder. 1997. A peptide antibiotic from human skin. Nature 387:861[Medline]. |
| 10. |
Jones, D. E., and C. L. Bevins.
1992.
Paneth cells of the human small intestine express an antimicrobial peptide gene.
J. Biol. Chem.
267:23216-23225 |
| 11. | Kohashi, O., T. Ono, K. Ohki, T. Soejima, T. Moriya, A. Umeda, Y. Meno, K. Amako, S. Funakosi, and M. Masuda. 1992. Bactericidal activities of rat defensins and synthetic rabbit defensins on staphylococci, Klebsiella pneumoniae (Chedid, 277, and 8N3), Pseudomonas aeruginosa (mucoid and nonmucoid strains), Salmonella typhimurium (Ra, Rc, Rd, and Re of LPS Mutants) and Escherichia coli. Microb. Immunol. 36:369-380. |
| 12. | Lehrer, R. I., T. Ganz, and M. E. Selsted. 1991. Defensins: endogenous antibiotic peptides of animal cells. Cell 64:229-230[Medline]. |
| 13. | Lehrer, R. I., A. K. Lichtenstein, and T. Ganz. 1993. Defensins: antimicrobial and cytotoxic peptides of mammalian cells. Annu. Rev. Immunol. 11:105-128[Medline]. |
| 14. | Makino, E., M. Namba, and J. Arata. 1996. Are anionic sites involved in changes in cell layer susceptibility to exfoliative toxin during epidermal development? Eur. J. Dermatol. 6:191-195. |
| 15. | Mor, A., V. H. Nguyen, A. Delfour, D. Migliore-Samour, and P. Nicolas. 1991. Isolation, amino acid sequence and synthesis of dermaseptin, a novel antimicrobial peptide of amphibian skin. Biochemistry 30:8824-3017[Medline]. |
| 16. | Nakashima, H., N. Yamamoto, M. Masuda, and N. Fujii. 1993. Defensins inhibit HIV replication in vitro. AIDS 7:1129[Medline]. (Letter.) |
| 17. |
Ogata, K.,
B. A. Linzer,
R. I. Zuberi,
T. Ganz,
R. I. Lehrer, and A. Catanzaro.
1992.
Activity of defensins from human neutrophilic granulocytes against Mycobacterium avium and Mycobacterium intracellulare.
Infect. Immun.
60:4720-4725 |
| 18. |
Ouellette, A. J.,
R. M. Greco,
M. James,
D. Frederick,
J. Naftilan, and J. T. Fallon.
1989.
Developmental regulation of cryptdin, a corticostatin/defensin precursor mRNA in mouse small intestinal crypt epithelium.
J. Cell Biol.
108:1687-1695 |
| 19. |
Ouellette, A. J.,
M. M. Hsieh,
M. T. Nosek,
D. F. Cano-Gauci,
K. M. Huttner,
R. N. Buick, and M. E. Selsted.
1994.
Mouse Paneth cell defensins: primary structures and antimicrobial activities of numerous cryptdin isoforms.
Infect. Immun.
62:5040-5047 |
| 20. | Ridge, J. P., E. J. Fuchs, and P. Matzinger. 1996. Neonatal tolerance revisited: turning on newborn T cells with dendritic cells. Science 271:1723-1726[Abstract]. |
| 21. |
Selsted, M. E., and S. S. Harwig.
1989.
Determination of the disulfide array in the human defensin HNP-2: a covalently cyclized peptide.
J. Biol. Chem.
264:4003-4007 |
| 22. |
Selsted, M. E.,
S. I. Miller,
A. H. Henschen, and A. J. Ouellette.
1992.
Enteric defensins: antibiotic peptide components of intestinal host defense.
J. Cell Biol.
118:929-936 |
| 23. | Senboshi, Y., T. Oono, and J. Arata. 1996. Prolidase gene expression in scar tissue using in situ hybridization. J. Dermatol. Sci. 12:163-171[Medline]. |
| 24. |
Zasloff, M.
1987.
Magainins, a class of antimicrobial peptides from Xenopus skin: isolation, characterization of two active forms, and partial cDNA sequence of a precursor.
Proc. Natl. Acad. Sci. USA
84:5449-5453 |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Antimicrob. Agents Chemother. | Clin. Microbiol. Rev. | Infect. Immun. |
|---|---|---|
| J. Clin. Microbiol. | J. Virol. | ALL ASM JOURNALS |