Previous Article | Next Article 
Clinical and Diagnostic Laboratory Immunology, September 1999, p. 760-764, Vol. 6, No. 5
1071-412X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of an IS711 Element
Interrupting the wboA Gene of Brucella abortus
Vaccine Strain RB51 and a PCR Assay To Distinguish Strain RB51 from
Other Brucella Species and Strains
Ramesh
Vemulapalli,1
John R.
McQuiston,1
Gerhardt G.
Schurig,1
Nammalwar
Sriranganathan,1
Shirley M.
Halling,2 and
Stephen
M.
Boyle1,*
Department of Biomedical Sciences and
Pathobiology, Center for Molecular Medicine and Infectious Diseases,
Virginia-Maryland Regional College of Veterinary Medicine, Virginia
Polytechnic Institute and State University, Blacksburg, Virginia
24061-0342,1 and National Animal Disease
Center, ARS, USDA, Ames, Iowa 500112
Received 7 December 1998/Returned for modification 5 April
1999/Accepted 22 June 1999
 |
ABSTRACT |
Brucella abortus vaccine strain RB51 is a natural
stable attenuated rough mutant derived from the virulent strain 2308. The genetic mutations that are responsible for the roughness and the attenuation of strain RB51 have not been identified until now. Also,
except for an assay based on pulsed-field gel electrophoresis, no other
simple method to differentiate strain RB51 from its parent strain 2308 is available. In the present study, we demonstrate that the
wboA gene encoding a glycosyltransferase, an enzyme
essential for the synthesis of O antigen, is disrupted by an
IS711 element in B. abortus vaccine strain
RB51. Exploiting this feature, we developed a PCR assay that
distinguishes strain RB51 from all other Brucella species
and strains tested.
| |
TEXT |
Brucella abortus is one
of six well-recognized species of the genus Brucella which
infects cattle as well as a variety of other mammals including humans
(1, 12). Infection with B. abortus leads to
abortions and reduced fertility in cattle. Vaccination with live,
attenuated B. abortus strains has been effective in preventing B. abortus infections and abortions in cattle.
Until recently, strain 19 (S19), a naturally occurring smooth and
attenuated strain of B. abortus, had been used as the
vaccine for cattle brucellosis. Similar to virulent B. abortus strains, the lipopolysaccharide of S19 also contains O
side chain, which is responsible for an immunodominant antibody
response after vaccination or infection with field strains. S19
vaccination usually causes the appearance of a transient serologic
titer of antibody to Brucella O antigen, and in some
vaccinated cattle, these titers of antibody do persist (30).
Hence, at least in a few cases, conventional serological techniques
cannot be used to clearly distinguish field-infected from
S19-vaccinated cattle. B. abortus vaccine strain RB51 is a
stable, rough, and attenuated mutant that was derived from strain 2308, a smooth and virulent strain of B. abortus (25).
B. abortus RB51 was approved in the United States in 1996 for use as a vaccine for cattle, replacing S19. Since the
lipopolysaccharide of B. abortus RB51 is devoid of O side
chain, antibodies induced by vaccination with this strain do not
interfere with the conventional serology (27). The stability
and vaccine efficacy of B. abortus RB51 have been well
studied and documented (8, 9, 16, 18, 22). However, the
genetic bases for the rough phenotype and attenuation in this strain
are not known. Also, except for a pulsed-field gel
electrophoresis-based assay (16), no other DNA-based method
to distinguish B. abortus RB51 from its parent strain 2308 or similar field strains is available. Previously, we characterized the
wboA gene of B. abortus that encodes
glycosyltransferase, an enzyme essential in the biosynthesis of O
antigen (19). We also demonstrated that disruption of the
wboA gene in smooth strains B. abortus 2308, Brucella melitensis 16M, and Brucella suis biovar 4 resulted in conversion to a rough phenotype (19,
29 [in reference 29, the wboA
gene was designated rfbU]). We have discovered that the
wboA gene in B. abortus RB51 is disrupted by an
IS711-like element. Based on this genetic feature, we have
developed a PCR assay that can distinguish RB51 from other
Brucella species and strains, including its parent, virulent
strain 2308.
Interruption of the wboA gene by an IS711
element in B. abortus RB51.
The wboA gene
along with the flanking nucleotide sequences was amplified by PCR from
the genomic DNAs of B. abortus RB51 and 2308. B. abortus genomic DNAs were extracted and purified as described previously (14). The primers (forward primer, 5'
GGATGTCGACCAGCCCTCCACATCAATAGC 3'; reverse primer, 5'
TTGCGGATCCTTTACTCGTCCGTCTCTTAC 3') used for the amplification
were designed based on the previously described nucleotide sequence of
the wboA gene from strain 2308 (19) (GenBank accession no. AF107768). PCR was performed with Ready-To-Go PCR beads
(Pharmacia Biotech) and a thermal cycler (Hybaid). Each PCR tube
contained 0.5 µM (each) primer and 5 ng of genomic DNA in a total
volume of 25 µl. Amplification was performed for 40 cycles, each
cycle comprising denaturation at 95°C for 1 min, annealing at 53°C
for 30 s, and extension at 72°C for 1 min. The amplified
products were separated by electrophoresis on a 0.8% agarose gel,
stained with ethidium bromide, and viewed under UV light. The amplified
product from RB51 genomic DNA was ~3 kb in size, which was ~900 bp
larger than that from 2308 (data not shown). The PCR products were
cloned in a pCR2.1 vector (Invitrogen, Inc.), and the nucleotide
sequences of both strands were determined at the DNA Sequencing
Facility of the Iowa State University (Ames). Computer analysis of the
nucleotide sequence from RB51 revealed that the wboA gene
was interrupted by an 842-bp fragment (Fig. 1). A BLAST search (2) (BLASTN
program) indicated that the 842-bp fragment was almost identical to the
previously described Brucella IS711 element (Fig.
2). IS711 is an insertion
sequence of 842 bp initially found in Brucella ovis
downstream to the gene encoding BCSP31 (13). This element
was also discovered and sequenced by Ouahrani and colleagues
(20), who designated the element IS6501. The
element is present in five or more copies in Brucella spp.
and appears to be quite stable in number and position in the chromosome
(5, 6, 14). However, differences in the number of elements
have been reported. B. abortus biovar 1 has at least six
copies of IS711, but B. abortus 2308 and RB51
have tandem IS711 copies at one locus (6).
View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Schematic diagram showing the interruption of the
wboA gene by an IS711 element (IS711J)
in B. abortus RB51 and the location of primers (small
arrows) used in the PCR assay. (B) Nucleotide sequences of the primers
used in the PCR assay.
|
|
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of the sequences of IS711
(accession no. M94960) and the IS711-like element,
IS711J, interrupting the wboA gene in B. abortus RB51. Ten base pairs of sequence flanking
IS711J is also shown. Nucleotide residues varying between
the two elements are indicated by lowercase, boldface, and
underlining.
|
|
Sequence features of the IS711 element.
The
IS711 element present in the wboA gene of
B. abortus RB51 was designated IS711J. Comparison
of IS711J with the IS711 element of B. ovis indicated 98.6% identity with specific nucleotide sequence differences (Fig. 2). The IS711J element is consistent with
the IS711 elements with regard to insertion within the
sequence 5' CTAG 3' and duplication of the sequence 5' TA 3'
(13).
Minor sequence variation among the IS
711 copies exists in
B. ovis (
13). The sequence variation occurs at
specific loci within
the element, with the ends of the elements being
much more polymorphic
than the coding regions (
6a,
13). All
the polymorphisms were
at sites identified previously by sequencing the
common copies
of the element in brucellae (
4,
6a). Only one
of these sites,
bp 747, differentiates the sequence of
IS
711J from that of other
B. abortus
IS
711 copies. All the IS
711 copies in
B. abortus, including
IS
711J, are distinct from the other
Brucella spp. IS
711 elements
because they have an
A at positions 2 and 3 in one end of the
element. All the rest of the
elements have G or C at these positions.
Transposition of the
IS
711 elements in brucellae does not appear
to be limited to
a specific copy or originate from a single locus,
as unique copies of
the element in
B. ovis and IS
711J of
B. abortus vary in
sequence.
B. abortus RB51-specific PCR assay.
Exploiting the
nature of wboA gene disruption by IS711J, we
developed a PCR assay that can distinguish B. abortus RB51
from all other Brucella species and strains. Based on
computer analysis (Primer Select program, LaserGene software; DNAStar
Inc.), two primers, primers 1 and 3 (Fig. 1), were selected so that the
amplified fragment from strain RB51 is ~1,300 bp and the fragments
from all other Brucella species (assuming an intact
wboA gene) are ~400 bp. An additional primer, primer 2 (Fig. 1), was selected manually to encompass the junction between the
wboA gene and the 5' end of IS711J. Five
nanograms of purified Brucella genomic DNA was used as
template for the PCR amplification. In some cases (see Table 1), a
medium-sized (2 mm in diameter) bacterial colony was taken from an agar
plate and resuspended in 200 µl of sterile distilled water, incubated
in a boiling water bath for 15 min, and centrifuged for 5 min at
10,000 × g, and 10 µl of the supernatant was used as
template. PCR amplifications were performed in a 25-µl total volume
with Ready-To-Go PCR beads. Amplification was performed for 40 cycles,
each cycle comprising denaturation at 95°C for 1 min, annealing at
62°C for 1 min, and extension at 72°C for 1.5 min. These parameters
were selected after several trials to optimize the conditions for
appropriate stringency (as determined by the absence of any undesired
nonspecific bands) and better yield of the amplified product(s). Three
different PCR amplifications were performed with primer combinations of
primers 1 and 3; primers 2 and 3; and primers 1, 2, and 3. In reaction
mixtures containing two primers, 0.5 µM (each) primer was included.
Whereas in reaction mixtures containing all three primers, 0.5 µM
(each) primers 1 and 2 and 1 µM primer 3 were included. Initial PCR
amplifications were performed with genomic DNA from strains RB51 and
2308. As shown in Fig. 3, different sizes
of fragments were amplified when primers 1 and 3 were used (~1,300-bp
fragment from RB51 and ~400-bp fragment from 2308). Primers 2 and 3 amplified a 900-bp fragment from the RB51 genomic DNA but none from
that of 2308.
View larger version (81K):
[in this window]
[in a new window]
|
FIG. 3.
Differentiation of B. abortus RB51 from its
parent strain 2308 by a wboA gene-based PCR assay. PCR
amplifications with the indicated primer pairs were performed with the
purified genomic DNA from strains RB51 and 2308 as templates. Negative
( ve) controls contained no template DNA. The amplified products were
separated on a 0.8% agarose gel, stained with ethidium bromide, and
photographed under UV light. Numbers at left indicate the 1-kb DNA
ladder fragment sizes in base pairs.
|
|
When all three primers were used in the reaction, fragments of expected
sizes were amplified (400 bp from 2308 and 900 and
1,300 bp from RB51).
In addition, a band of ~2.3 kb in size was
also amplified in RB51
(Fig.
3). The 900-bp and the 2.3-kb bands
in strain RB51 were of lower
intensity, indicating that there
was some inhibition in the
amplification. Adjustments of several
parameters, including the
concentration of Mg
2+, primers, deoxynucleoside
triphosphates, or changes in annealing
temperature, did not result in
either enhancement of the amplified
products or absence of the 2.3-kb
fragment. The low level of amplification
of the 900-bp fragment is most
probably due to the 5'
3' exonuclease
activity of
Taq DNA
polymerase; while extending primer 1,
Taq DNA polymerase
could have degraded the DNA strand that was being
extended from primer
2 (primers 1 and 2 bind to the same template
in strain RB51 [Fig.
1])
(
15). Some of the single-stranded DNA
fragments resulting
from the degradation of the DNA strand that
was initiated by primer 2 might have primed for the amplification
of the 2.3-kb fragment. This
appears likely, since the ~2.3-kb
band appeared only when all three
primers were used in the amplification
reaction. No such problem is
encountered with strain 2308, since
primer 2 cannot bind to the
template; again this supports, though
indirectly, the above hypothesis
for the low level of amplification
of the 900-bp fragment and the
appearance of the 2.3-kb band in
the case of RB51. We tested the
specificity of this strain-specific
PCR assay with various
Brucella strains (Table
1). As
shown in
Fig.
4, when the three primers
were used for the PCR assay, all
the other
Brucella strains
tested gave an amplified product of
400 bp in size; identical results
were obtained by using only
primers 1 and 3 (data not shown). No
amplified products were detectable
when the template was genomic DNA
from bacteria that are closely
related to
Brucella species,
Ochrobactrum anthropi 49237 and 49188.
Also, no products
could be amplified from the genomic DNAs of
Yersinia
enterocolitica O:9, which synthesizes O antigen that
is identical
to that of
Brucella (reference
7 and data
not
shown). Based on these results, we recommend the PCR assay with
primers 1 and 3 to distinguish strain RB51 from all other
Brucella strains. It should be mentioned that several
attempts to clone
the 2.3-kb fragment present in the amplified products
of strain
RB51 were unsuccessful. Amplification of the 400-bp fragment
from
B. ovis and
Brucella canis indicates that
these naturally rough
species contain the
wboA gene
sequences. However, further studies
are needed to confirm the
intactness and functionality of the
wboA gene in these
species, since the mere presence of a gene
sequence does not
necessarily result in expression of a functional
product.
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 4.
PCR assay to differentiate B. abortus RB51
from all other Brucella species and strains. Primers 1, 2, and 3 were used in all PCR amplifications. Genomic DNA from the
indicated Brucella strains was used as template. Negative
(ve) controls contained no template DNA. The amplified products were
separated on a 0.8% agarose gel, stained with ethidium bromide, and
photographed under UV light. Numbers at left indicate the 1-kb DNA
ladder fragment sizes in base pairs.
|
|
Even though the stability of RB51 is well proven in vivo and in vitro,
the actual genetic mutation(s) that contributed to
the rough phenotype
and attenuation of this strain has not been
identified until now. This
study describes the first such mutation
in the
wboA gene. It
is clear from previous studies that deletion
of the
wboA
gene in
B. melitensis,
B. abortus, and
B. suis leads
to the rough phenotype and attenuation (
19,
29). Ongoing studies
in our laboratory indicated that
complementation of RB51 with
a functional
wboA gene resulted
in O antigen production but did
not result in reversion to the smooth
phenotype and did not affect
attenuation (unpublished data). This
suggests that RB51 contains
an additional genetic mutation(s) that
probably affects either
the export of O antigen to the bacterial
surface, the coupling
of O antigen to core lipopolysaccharide, or
both.
Recently, several PCR assays to detect or differentiate various
Brucella strains have been reported (
3,
5,
6,
17,
21,
23,
26,
28). However, none of these assays could distinguish
RB51
from its parent, virulent strain 2308. A PCR assay with primers
1 and
3, as described in this paper, can be used to quickly identify
RB51;
hence, it should be useful in studies where detecting the
presence of
RB51 is needed, such as those with the risk of potential
abortions,
which can occur if pregnant animals are vaccinated
with RB51, and in
studies where the fate of RB51 has to be determined
after vaccination
of bison and other wild as well as domestic
animals. We successfully
used this PCR assay to quickly verify
the presence or absence of RB51
among field
Brucella isolates
cultured from aborted bovine
fetuses (unpublished
data).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biomedical Sciences and Pathobiology, Center for Molecular Medicine and Infectious Diseases, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061-0342. Phone: (540) 231-4641. Fax: (540) 231-3426. E-mail: smboyle{at}vt.edu.
| |
REFERENCES |
| 1.
|
Acha, P., and B. Szyfres.
1980.
Zoonoses and communicable diseases common to man and animals, p. 28-45.
Pan American Health Organization, Washington, D.C.
|
| 2.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 3.
|
Baily, G. G.,
J. B. Krahn,
B. S. Drasar, and N. G. Stoker.
1992.
Detection of Brucella melitensis and Brucella abortus by DNA amplification.
J. Trop. Med. Hyg.
95:271-275[Medline].
|
| 4.
|
Bricker, B. J., and S. M. Halling.
1992.
DNA sequence divergence of IS711: a theory on the progression of transposition events. International Congress on the E. coli, p. 1992.
Genome, Madison, Wis.
|
| 5.
|
Bricker, B. J., and S. M. Halling.
1994.
Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR.
J. Clin. Microbiol.
32:2660-2666[Abstract/Free Full Text].
|
| 6.
|
Bricker, B. J., and S. M. Halling.
1995.
Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51.
J. Clin. Microbiol.
33:1640-1642[Abstract].
|
| 6a.
| Bricker, B. J., and S. M. Halling.
Unpublished data.
|
| 7.
|
Caroff, M.,
D. R. Bundle,
M. B. Perry,
J. W. Cherwonograodzky, and J. R. Duncan.
1984.
Antigenic S-type lipopolysaccharide of Brucella abortus 1119-3.
Infect. Immun.
46:384-388[Abstract/Free Full Text].
|
| 8.
|
Cheville, N. F.,
A. E. Jensen,
S. M. Halling,
F. M. Tatum,
D. C. Morfitt,
S. G. Hennager,
W. M. Frerichs, and G. G. Schurig.
1992.
Bacterial survival, lymph node changes, and immunologic responses of cattle vaccinated with standard and mutant strains of Brucella abortus.
Am. J. Vet. Res.
53:1881-1888[Medline].
|
| 9.
|
Cheville, N. F.,
M. G. Stevens,
A. E. Jensen,
F. M. Tatum, and S. M. Halling.
1993.
Immune responses and protection against infection and abortion in cattle experimentally vaccinated with mutant strains of Brucella abortus.
Am. J. Vet. Res.
54:1591-1597[Medline].
|
| 10.
|
Chukwu, C. C.
1985.
The instability of Brucella abortus strain 45/20 and a note on significance of using an unstable rough strain in the diagnosis of bovine brucellosis.
Int. J. Zoonoses
12:120-125[Medline].
|
| 11.
|
Cloeckaert, A.,
M. S. Zygmunt,
J.-C. Nicolle,
G. Dubray, and J. N. Limet.
1992.
O-chain expression in the rough Brucella melitensis strain B115: induction of O-polysaccharide-specific monoclonal antibodies and intracellular localization demonstrated by immunoelectron microscopy.
J. Gen. Microbiol.
138:1211-1219[Abstract/Free Full Text].
|
| 12.
|
Corbel, M. J.
1997.
Brucellosis: an overview.
Emerg. Infect. Dis.
3:213-221.
[Medline] |
| 13.
|
Halling, S. M.,
F. M. Tatum, and B. J. Bricker.
1993.
Sequence and characterization of an insertion sequence, IS711, from Brucella ovis.
Gene
133:123-127[Medline].
|
| 14.
|
Halling, S. M., and E. S. Zehr.
1990.
Polymorphism in Brucella spp. due to highly repeated DNA.
J. Bacteriol.
172:6637-6640[Abstract/Free Full Text].
|
| 15.
|
Holland, P. M.,
R. D. Abramson,
R. Watson, and D. H. Gelfand.
1991.
Detection of specific polymerase chain reaction product by utilizing the 5' to 3' exonuclease activity of Thermus aquaticus DNA polymerase.
Proc. Natl. Acad. Sci. USA
88:7276-7280[Abstract/Free Full Text].
|
| 16.
|
Jensen, A. E.,
D. R. Ewalt,
N. F. Cheville,
C. O. Thoen, and J. B. Payeur.
1996.
Determination of stability of Brucella abortus RB51 by use of genomic fingerprint, oxidative metabolism, and colonial morphology and differentiation of strain RB51 from B. abortus isolates from bison and elk.
J. Clin. Microbiol.
34:628-633[Abstract].
|
| 17.
|
Leal-Klevezas, D. S.,
I. O. Martinez-Vazquez,
A. Lopez-Merino, and J. P. Martinez-Soriano.
1995.
Single-step PCR for detection of Brucella spp. from blood and milk of infected animals.
J. Clin. Microbiol.
33:3087-3090[Abstract].
|
| 18.
|
Lord, V. R.,
G. G. Schurig,
J. W. Cherwonogrodzky,
M. J. Marcano, and G. E. Melendez.
1998.
Field study of vaccination of cattle with Brucella abortus strains RB51 and 19 under high and low disease prevalence.
Am. J. Vet. Res.
59:1016-1020[Medline].
|
| 19.
|
McQuiston, J. R.,
R. Vemulapalli,
T. J. Inzana,
G. G. Schurig,
N. Sriranganathan,
D. Fritzinger,
T. L. Hadfield,
R. A. Warren,
N. Snellings,
D. Hoover,
S. M. Halling, and S. M. Boyle.
1999.
Genetic characterization of a Tn5-disrupted glycosyltransferase gene homolog in Brucella abortus and its effect on lipopolysaccharide composition and virulence.
Infect. Immun.
67:3830-3835[Abstract/Free Full Text].
|
| 20.
|
Ouahrani, S.,
S. Michaux,
J. Sriwidada,
G. Bourg,
R. Tournebize,
M. Ramuz, and J. P. Liautard.
1993.
Identification and sequence analysis of IS6501, an insertion sequence in Brucella spp.: relationship between genomic structure and the number of IS6501 copies.
J. Gen. Microbiol.
139:3265-3273[Abstract/Free Full Text].
|
| 21.
|
Ouahrani-Bettache, S.,
M. P. Soubrier, and J. P. Liautard.
1996.
IS6501-anchored PCR for the detection and identification of Brucella species and strains.
J. Appl. Bacteriol.
81:154-160[Medline].
|
| 22.
|
Palmer, M. V.,
S. C. Olsen, and N. F. Cheville.
1997.
Safety and immunogenicity of Brucella abortus strain RB51 vaccine in pregnant cattle.
Am. J. Vet. Res.
58:472-477[Medline].
|
| 23.
|
Romeno, C.,
C. Gamazo,
M. Pardo, and I. Lopez-Goni.
1995.
Specific detection of Brucella DNA by PCR.
J. Clin. Microbiol.
33:615-617[Abstract].
|
| 24.
|
Roop, R. M.,
D. Preston-Moore,
T. Bagchi, and G. G. Schurig.
1987.
Rapid identification of smooth Brucella species with a monoclonal antibody.
J. Clin. Microbiol.
25:2090-2093[Abstract/Free Full Text].
|
| 25.
|
Schurig, G. G.,
R. M. Roop,
T. Bagchi,
S. Boyle,
D. Buhrman, and N. Sriranganathan.
1991.
Biological properties of RB51: a stable rough strain of Brucella abortus.
Vet. Microbiol.
28:171-188[Medline].
|
| 26.
|
Sifuentes-Rincon, A. M.,
A. Revol, and H. A. Barrera-Saldana.
1997.
Detection and differentiation of the six Brucella species by polymerase chain reaction.
Mol. Med.
3:734-739[Medline].
|
| 27.
|
Stevens, M. G.,
S. G. Hennager,
S. C. Olsen, and N. F. Cheville.
1994.
Serologic responses in diagnostic tests for brucellosis in cattle vaccinated with Brucella abortus 19 or RB51.
J. Clin. Microbiol.
32:1065-1066[Abstract/Free Full Text].
|
| 28.
|
Tcherneva, E.,
N. Rijpens,
C. Naydensky, and L. Herman.
1996.
Repetitive element sequence based polymerase chain reaction for typing of Brucella strains.
Vet. Microbiol.
51:169-178[Medline].
|
| 29.
|
Winter, A. J.,
G. G. Schurig,
S. M. Boyle,
N. Sriranganathan,
J. S. Bevins,
F. M. Enright,
P. H. Elzer, and J. D. Kopec.
1996.
Protection of BALB/c mice against homologous and heterologous species of Brucella by rough strain vaccines derived from Brucella melitensis and Brucella suis biovar 4.
Am. J. Vet. Res.
57:677-683[Medline].
|
| 30.
|
Woodard, L. F.
1981.
Do we need another brucellosis vaccine?
Mod. Vet. Pract.
62:857-859[Medline].
|
Clinical and Diagnostic Laboratory Immunology, September 1999, p. 760-764, Vol. 6, No. 5
1071-412X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yazdi, H. S., Kafi, M., Haghkhah, M., Tamadon, A., Behroozikhah, A. M., Ghane, M.
(2009). Abortions in pregnant dairy cows after vaccination with Brucella abortus strain RB51. Vet Rec.
165: 570-571
[Full Text]
-
Garcia-Yoldi, D., Marin, C. M., de Miguel, M. J., Munoz, P. M., Vizmanos, J. L., Lopez-Goni, I.
(2006). Multiplex PCR Assay for the Identification and Differentiation of all Brucella Species and the Vaccine Strains Brucella abortus S19 and RB51 and Brucella melitensis Rev1.. Clin. Chem.
52: 779-781
[Full Text]
-
Halling, S. M., Peterson-Burch, B. D., Bricker, B. J., Zuerner, R. L., Qing, Z., Li, L.-L., Kapur, V., Alt, D. P., Olsen, S. C.
(2005). Completion of the Genome Sequence of Brucella abortus and Comparison to the Highly Similar Genomes of Brucella melitensis and Brucella suis. J. Bacteriol.
187: 2715-2726
[Abstract]
[Full Text]
-
Olsen, S. C., Rhyan, J., Gidlewski, T., Goff, J., Stoffregen, W. C.
(2004). SAFETY OF BRUCELLA ABORTUS STRAIN RB51 IN BLACK BEARS. J Wildl Dis
40: 429-433
[Abstract]
[Full Text]
-
Fernandez-Prada, C. M., Zelazowska, E. B., Nikolich, M., Hadfield, T. L., Roop II, R. M., Robertson, G. L., Hoover, D. L.
(2003). Interactions between Brucella melitensis and Human Phagocytes: Bacterial Surface O-Polysaccharide Inhibits Phagocytosis, Bacterial Killing, and Subsequent Host Cell Apoptosis. Infect. Immun.
71: 2110-2119
[Abstract]
[Full Text]
-
Fernandez-Prada, C. M., Nikolich, M., Vemulapalli, R., Sriranganathan, N., Boyle, S. M., Schurig, G. G., Hadfield, T. L., Hoover, D. L.
(2001). Deletion of wboA Enhances Activation of the Lectin Pathway of Complement in Brucella abortus and Brucella melitensis. Infect. Immun.
69: 4407-4416
[Abstract]
[Full Text]
-
Cloeckaert, A., Grayon, M., Grepinet, O.
(2000). An IS711 Element Downstream of the bp26 Gene Is a Specific Marker of Brucella spp. Isolated from Marine Mammals. CVI
7: 835-839
[Abstract]
[Full Text]
-
Vemulapalli, R., He, Y., Buccolo, L. S., Boyle, S. M., Sriranganathan, N., Schurig, G. G.
(2000). Complementation of Brucella abortus RB51 with a Functional wboA Gene Results in O-Antigen Synthesis and Enhanced Vaccine Efficacy but No Change in Rough Phenotype and Attenuation. Infect. Immun.
68: 3927-3932
[Abstract]
[Full Text]
Top
Abstract
Text
