INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The CC-CKR5 (or CCR5) cell surface molecule serves as the natural receptor for the CC (or )-chemokines (reviewed in reference 16). The CCR5 molecule has also been shown to serve as a coreceptor, along with the CD4 molecule, for the entry of macrophage-tropic, non-syncytium-inducing (i.e., primary) strains of human immunodeficiency virus type 1 (HIV-1) during infection (1, 7). A series of studies have demonstrated that the CCR5 genotype is important in determining host susceptibility to HIV-1 infection, as well as in determining disease progression (9, 15). For example, it was demonstrated that cells from two HIV-1-negative individuals with multiple exposures to HIV-1⁺ patients were resistant to infection by primary macrophage-tropic virus in vitro (12). Sequence analysis determined that both of these individuals encoded the same homozygous deletion mutation of 32 bp in the CCR5 gene. This deletion mutation in both alleles of the gene results in a truncated form of the receptor that is not detected on the cell surface. A more extensive survey of patients has revealed that approximately 3% of 612 HIV-1-exposed but antibody-negative individuals were homozygous for this deletion mutation (6). In the same study, it was shown that the deletion allele occurred at a frequency of about 0.10 in the U.S. Caucasian population. There were no homozygous deletion mutations detected among more than 1,300 HIV-1⁺ patients, and the frequency of heterozygosity for the mutation was elevated among patients surviving for more than 10 years. Interestingly, the deletion mutation appears to be of low prevalence among people of Asian or African ancestry (9). The relevance of the CCR5 receptor in HIV-1 infection is further established by the observation that the -chemokines RANTES, MIP-1, and MIP-1 (which naturally bind the CCR5 receptor) will block infection of macrophage-tropic isolates of HIV-1 in vitro (5).

The studies which addressed the CCR5 genotype and its role in HIV-1 pathogenesis involved the use of several molecular methods for the genotyping process. In this report, we describe the use of the isothermal nucleic acid sequence-based amplification (NASBA) method for CCR5 genotyping analysis. NASBA (10) is an isothermal process that is highly appropriate for the amplification of RNA. Amplification is achieved through the coordinated activities of three enzymes (avian myeloblastosis virus reverse transcriptase, RNase H, and T7 RNA polymerase) and two DNA oligonucleotides that are specific for the target sequence of interest. Amplification in NASBA is transcription based and results in the production of large amounts of single-stranded RNA that is antisense to the original target sequence. The single-stranded RNA product can then be readily detected through the hybridization of an appropriately labeled oligonucleotide DNA probe. With CCR5, a single NASBA system which amplifies both the wild-type and the mutated alleles was designed. Discrimination between the two amplification products was achieved at the detection step by means of independent hybridizations with wild-type- and mutation-specific probes. It is the abundance of the CCR5 transcript in patient peripheral blood mononuclear cells (PBMC) and the appropriateness of NASBA for RNA amplification which enabled development of this genotyping assay. The isothermal nature of the amplification procedure along with an easily detected single-stranded RNA amplification product further justifies the use of NASBA technology in genotyping analyses.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Obtaining and processing of biological samples. After obtaining informed consent, whole-blood samples were collected in VACUTAINER EDTA anticoagulant tubes (Becton Dickinson, Franklin Lakes, N.J.) from 89 randomly selected HIV-1-seropositive patients attending the North Shore University Hospital Center for AIDS Research and Treatment (Manhasset, N.Y.). Additional samples were collected from four human T-cell leukemia virus type 1 (HTLV-1)-positive patients and four HIV-1-seronegative persons with a history of high-risk exposure to HIV-1. Whole bloods were centrifuged for 20 min at 1,000 × g in a swinging-bucket rotor (Spinchron R; Beckman Instruments, Fullerton, Calif.) within 4 h of specimen collection. PBMC were obtained from the whole blood either by centrifugation through Ficoll Hypaque or through the use of cell preparation tubes (Becton Dickinson). Resulting PBMC were either viably cryopreserved for use later or processed directly for nucleic acid extractions. Nucleic acids were isolated from approximately 10⁵ cells (NASBA assay only) or 2 × 10⁶ cells (NASBA and PCR assays) by the guanidine isothiocyanate-acidified silica procedure of Boom et al. (3). After isolation, 5 to 10% of the nucleic acid extract was used in the NASBA reactions and PCRs. Alternatively, to obtain total RNA, the method of Chomczynski and Sacchi (4) was used.

Amplification by NASBA of CCR5 transcript RNA. Amplification by the NASBA technique was achieved by a modified version of the procedure of Romano et al. (18). Briefly, the 20-µl amplification reaction mixture contained 5 µl of the nucleic acid extract material in a solution containing 40 mM Tris (pH 8.5); 5 mM dithiothreitol; 12 mM MgCl₂; 70 mM KCl; 2.0 mM (each) ATP, CTP, and UTP; 1.5 mM GTP; 0.5 mM ITP; 1.0 mM (each) dATP, dCTP, dGTP, and dTTP; 0.1 µg of bovine serum albumin per µl; 0.1 U of RNase H; 40 U of T7 RNA polymerase; 8 U of avian myeloblastosis virus reverse transcriptase; 15% dimethyl sulfoxide; and 0.2 µM (each) oligonucleotides (P1 and P2). Two sets of oligonucleotides, specific for CCR5 amplification, were synthesized. Design of these oligonucleotides was based on the reported sequence for the CCR5 gene (GenBank accession no. U57840), and the oligonucleotides were as follows: P1A, 5' AATTCTAATACGACTCACTATAGGGAGCAGCGGCAGGACCAGCCCCA 3'; P1B, 5' AATTCTAATACGACTCACTATAGGGAGAGATTCCCGAGTAGCAGATGACCATGA 3'; P2A, 5' GGCTGTGTTTGCGTCTCTCCCA 3'; and P2B, 5' TTTGGGGTGGTGACAAGTGTGATCA 3'. The italicized sequences of the P1 oligonucleotides (A and B) indicate the overhang portion encoding the T7 RNA polymerase promoter. All four P1-P2 oligonucleotide combinations were evaluated for performance in the NASBA system.

Hybridization analysis of CCR5 NASBA products. The portion of the CCR5 gene targeted by the specified oligonucleotides spans positions 430 through 650 (the A of the ATG methionine is base 1). The probe for the wild-type amplification product (5' AGTATCAATTCTGGAAGAATTTCCA 3', used in electrochemiluminescence [ECL] or ³²P-based detection) anneals to the positions corresponding to bases 557 to 581, which are within the 32-base deleted portion of the mutated allele. The Ru²⁺-labeled probe specific for the mutated allele corresponds to base positions 546 to 553 and 586 to 593; however, the probe is a continuous oligonucleotide corresponding to these regions. The sequence of this mutation-specific ECL detector probe is 5' TCCATACA:TTAAAGAT 3' (the colon signifies the junction site). Therefore, this probe should hybridize only to the mutated form of the gene, where base 553 is immediately adjacent to base 586 due to the deletion. Similarly, the probe used for ³²P-based detection of the mutated allele (5' TCATTTTCCATACA:TTAAAGATAGTCAT 3') corresponds to positions 540 to 553:586 to 599. Figure 1 illustrates the position of the CCR5 NASBA primers and probes. NASBA products were analyzed by probe hybridization in one of two ways. In method 1, amplification products were vacuum transferred to nylon membranes in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) buffer with a slot blot apparatus or after electrophoretic resolution through agarose gels followed by vacuum transfer. After transfer, the blots were hybridized with probes that were 5' end labeled with ³²P by standard methods. After hybridization (16 to 20 h), blots were washed three to four times with 1× SSC-1% sodium dodecyl sulfate at 50°C and exposed in autoradiography. In method 2, the alternative detection strategy involved the use of an ECL detection system (2). In this system, the wild-type and mutation probes are labeled with ruthenium (Ru²⁺), the compound responsible for the ECL signal. Amplification products were first diluted by a factor of 10 to 40 and hybridized separately in liquid phase with Ru²⁺-labeled versions of either the wild-type or the mutation detector probe. Included in these liquid hybridization reaction mixtures was a capture probe (5' AAAGAAGGTCTTCATTACACCTGCAGC 3', positions 511 to 537) which was specific for a conserved sequence present in both wild-type and mutated allele amplification products. This capture probe was labeled at the 5' end with biotin and immobilized onto the surface of a streptavidin-coated magnetic bead (type 280; Dynal, Inc., Lake Success, N.Y.). This liquid hybridization involving the diluted NASBA reaction product, the immobilized capture probe, and either the wild-type or mutated Ru²⁺-labeled probe was conducted at 60°C for 5 min and then for 20 to 30 min at 41°C. Results were obtained by analysis of the hybridization reaction products in the NASBA QR System (Organon Teknika, Durham, N.C.), an ECL reader.

View larger version (16K): [in this window] [in a new window]   FIG. 1.   Strategy for genotyping at the CCR5 locus by NASBA. The wild-type CCR5 allele contains a 32-base sequence (black bar) which is deleted from the mutated allele. The oligonucleotides used for amplification by NASBA of the CCR5 mRNA were designed as shown with two antisense P1 oligonucleotides (A and B) downstream from the deletion site and two sense P2 oligonucleotides (A and B) upstream from the deletion site. Map positions are provided in Materials and Methods. All four combinations were used in initial amplification reaction evaluations. Resulting amplicons were screened by hybridization analysis with either the wild-type probe (WT), which is specific for the sequence that is deleted from the mutated allele, or with the mutation-specific probe (Mut), which straddles the resulting junction region created by the deletion. The capture probe, used in ECL detection of amplification products, is located immediately downstream from P2A (not shown). The P1A-P2B primer combination was used in all subsequent experiments.

Cloning of the wild-type and mutated CCR5 alleles. High-molecular-weight genomic DNA was purified from pooled buffy coat PBMC by standard methods. The DNA was subjected to PCR amplification (30 cycles by standard methods) with the following primer pair: a sense primer, 5' ATGGATTATCAAGTGTCAAGTCCAATCTAT 3', and an antisense primer, 5' TCACAAGCCCACAGATATTTCCTGCTC 3'. The resulting 1,059-bp PCR product was ligated directly into plasmid pCR2.1 (Invitrogen, Inc., Carlsbad, Calif.) and used to transform Escherichia coli INVF'. Probes specific for the CCR5 insert were used to screen the resulting transformants, and independent clones for each allele were obtained. Sequences of the clones were determined through a commercial service (Lark Technologies, Houston, Tex.). These clones were used to produce RNA corresponding to the wild-type and mutated CCR5 alleles by means of a Riboprobe in vitro transcription kit (Promega Corp., Madison, Wis.). After DNase treatment of the in vitro transcription products and purification with RNeasy (Qiagen, Inc., Santa, Clarita, Calif.), quantitation of this RNA was achieved by measuring the optical density at 260 nm in triplicate and using the mean value to calculate the copy number.

PCR amplification of CCR5 DNA. DNA PCR determination of CCR5 genotype was performed according to the previously described method (8). Briefly, the PCRs were performed in 50-µl volumes, each comprising 5 µl of nucleic acids, 5 µl of 10× PCR buffer (100 mM tris-HCl [pH 8.3], 500 mM KCl, 15 mM MgCl₂, 0.01% [wt/vol] gelatin), 0.2 mM each deoxynucleoside triphosphate, 50 pmol each of the sense (5' CAATGTGTCAACTCTTGACAGG 3') and antisense (5' ACCTGCATAGCTTGGTCCAACC 3') primers, 33.5 µl of distilled water, and 0.5 µl of Ampli Taq enzyme (Perkin-Elmer Corp., Foster City, Calif.). The DNAs in the reaction mixtures were denatured for 1 min at 94°C on a thermal cycler (PCR 9600 system; Perkin-Elmer Corp.) and subjected to 35 cycles of PCR amplification. Each cycle consisted of denaturation at 94°C for 30 s, followed by annealing at 58° for 30 s and then extension at 72°C for 30 s. Following the 35 cycles of PCR there was an extension for 10 min at 72°C.

Electrophoresis and detection of PCR-amplified products. Following PCR, the CCR5 amplified DNAs were electrophoretically separated on a 2% agarose gel stained with ethidium bromide. DNA fragments were visualized by UV scanning with a UVP gel documentation system (Integral Technologies, Inc.). Samples homozygous for the wild-type CCR5 allele demonstrate a single 547-bp amplicon, samples homozygous for the mutated (32-bp deletion) CCR5 allele demonstrate a single 515-bp amplicon, and samples with heterozygous CCR5 alleles demonstrate two DNA bands at 547 and 515 bp.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Basic assay performance. A schematic representation of the CCR5 genotyping NASBA assay is provided in Fig. 1. The approach was to conduct a single NASBA of RNA obtained from patient PBMC and subject the resulting amplicons to independent hybridization analyses with probes that are specific for either the wild-type or the mutated allele. Multiple oligonucleotides for CCR5 amplification by NASBA were designed such that there were two antisense P1 sequences downstream from the 32-base deletion mutation site and two sense P2 sequences upstream from this region (map positions 602 to 623 for P1A, 626 to 650 for P1B, 465 to 486 for P2A, and 430 to 454 for P2B). The wild-type-allele-specific probe was positioned in the 32-base region that is present only in the wild-type gene. The mutation-specific probe corresponded to the junction region that is created by the deletion event.

Sensitivity of the NASBA assay. Several strategies were employed to evaluate the sensitivity of the NASBA assay for CCR5 mRNA. Initially, it was determined that the assay could detect the CCR5 target mRNA sequence in as little as 50 pg of total RNA obtained from PBMC. In the standard NASBA reaction conducted with PBMC extracts obtained by the method of Boom et al. (3), CCR5 mRNA was readily detected with input material equivalent to 5,000 cells. However, a more informative evaluation of sensitivity requires the use of RNA produced in vitro that corresponds to the CCR5 target sequence. To obtain this RNA, PCR was conducted with genomic DNA that had been extracted from pooled human PBMC with primers that spanned the entire coding region of the CCR5 gene. Since the CCR5 gene does not contain introns, the DNA sequence is contiguous with the transcribed RNA (19). Further, the use of DNA extracted from pooled PBMC enhances the likelihood of both wild-type and mutated forms of the gene being amplified in the PCR. The resulting PCR product was ligated directly into the TA cloning vector pCR2.1, and bacterial transformants were screened with a ³²P-labeled capture probe (see Materials and Methods) which hybridizes to both wild-type and mutated clones. Through additional screening steps, independent clones harboring the wild-type and mutated CCR5 alleles were isolated and the identities of these clones were confirmed by means of DNA sequence analysis. The specific wild-type and mutated CCR5 plasmids were then used to produce separate batches of both forms of RNA by means of in vitro transcription.

View larger version (40K): [in this window] [in a new window]   FIG. 2.   Sensitivity and specificity of the CCR5 NASBA assay. Different input quantities (5 to 5,000 copies) of wild-type (WT) CCR5 RNA and RNA corresponding to the mutated allele (Mut) that were produced in vitro were amplified with the P1A-P2B oligonucleotide set. Detection of the amplification products was achieved with the ECL system described in Materials and Methods. Each input RNA was amplified in duplicate, and each reaction mixture was tested with both the WT- and Mut-specific probes. Results show that the assay is capable of at least 50-copy sensitivity (WT and Mut) and that there is no cross-reactivity between the specific probes on the alternative RNAs.

Analysis of patient PBMC samples. After the initial evaluation of the NASBA-based CCR5 assay, the system was applied to the analysis of patient PBMC samples. Nucleic acids were obtained by the silica-based extraction method of Boom et al. (3), which leads to the isolation of both RNA and DNA. However, the isothermal nature of NASBA renders the amplification method specific for the RNA versions of the targets; there is no opportunity for a double-stranded DNA molecule to denature. Therefore, there is no contribution to the NASBA product from the background DNA obtained from the cells. After amplification as described earlier, reaction products were subjected to both ³²P-labeled probe detection and ECL-based hybridization analysis. For the ³²P-labeled probe detection system, duplicate 5-µl aliquots of the NASBA reaction product were either resolved through independent agarose gels and then vacuum transferred to nylon membranes or vacuum transferred directly as slot blots. After independent hybridizations with the allele-specific probes, the genotypes of individual patients could be determined by scoring for the presence or absence of bands on the resulting autoradiograms. A homozygous wild-type genotype was indicated by the presence of a band only on the wild-type probe autoradiogram; the homozygous mutation genotype was indicated by the presence of a band only on the mutation probe autoradiogram. Heterozygotes had bands on both autoradiograms. Results from an analysis of eight patients are summarized in Fig. 3. Evaluation of these autoradiograms indicated that patients 2, 3, 4, and 8 were homozygous for the wild-type allele and that patients 1, 5, 6, and 7 were heterozygous at the CCR5 locus.

View larger version (52K): [in this window] [in a new window]   FIG. 3.   CCR5 NASBA genotyping analysis of patient PBMC by 32P-labeled-probe detection. Approximately 5% of the nucleic acid extracts obtained from patient PBMCs were amplified with the P1A-P2B CCR5 NASBA assay oligonucleotide set. The reaction products were resolved in duplicate agarose gels and then vacuum transferred to nylon membranes. Each membrane was hybridized with a 32P-labeled version of either the wild type (upper blot)- or mutation (lower blot)-specific CCR5 probes. Lanes 1 to 8 contain patient PBMC samples; lanes 9 and 10 contain negative (water) controls; lanes WT contain 105 copies of wild-type CCR5 RNA; and lanes Mut contain 105 copies of mutated CCR5 RNA.

View larger version (37K): [in this window] [in a new window]   FIG. 4.   CCR5 NASBA genotyping analysis of patient PBMC by ECL detection. (A) Analysis of control samples. Assay-negative (AN) ECL signals were obtained for Ru2+ versions of the wild-type (WT)- and mutation (Mut)-specific probes by hybridization with a magnetic-bead-immobilized capture probe and without amplicon material. Water-only controls were also amplified in duplicate and subjected to analysis with the WT and Mut probes. ECL signals for these controls were equivalent to background levels. Positive-control reaction mixtures consisted of 50,000 copies of in vitro-produced WT RNA or 50,000 copies of in vitro-produced Mut RNA. (B) Analysis of patient PBMC samples. Amplification products obtained for the same eight patients whose results are depicted in Fig. 3 were subjected to ECL-based detection analysis by independent hybridization with the WT and Mut probes.

View larger version (45K): [in this window] [in a new window]   FIG. 5.   CCR5 genotyping by NASBA and DNA PCR. (A) NASBA products generated from the PBMC of eight patients were subjected to ECL-based detection analysis by independent hybridization with wild-type (WT)- and mutation (Mut)-specific probes. Bars WT Con, wild-type control samples produced signals with only the WT probe; bars Mut Con, mutation control samples produced signals with only the Mut probe; bars Neg Con, negative-control samples had undetectable signals with both probes. The PBMC of patients 3, 6, 7, 8, and 10 (bars so numbered) produced positive signals with the WT probe only, indicating a homozygous wild-type genotype. The PBMC of patients 4 and 9 produced signals with both the WT and Mut probes, indicating a heterozygous (wild-type/32-bp-deletion) genotype. The PBMC of patient 5 produced a positive signal with the Mut probe only, indicating a homozygous 32-bp-deletion genotype. (B) CCR5 PCR amplification products generated from PBMC from the same eight patients whose results are shown in panel A were visualized by ethidium bromide staining after electrophoresis on a 2% agarose gel. Three different amplification patterns were observed. Lane 1, DNA size marker; lane 2, negative water PCR control (no bands visualized); lanes 3, 6, 7, 8, and 10, homozygous wild-type amplicons (547-bp band); lanes 4 and 9, heterozygous deletion amplicons (547- and 515-bp bands); lane 5, homozygous deletion amplicons (515-bp band).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The CCR5 gene encodes a cell surface chemokine receptor molecule that also functions as a coreceptor for macrophage-tropic isolates of HIV-1. Importantly, a naturally occurring mutated allele for the CCR5 gene which encodes a 32-base deletion has been identified. This mutated allele produces a truncated form of the protein that is not expressed on the cell surface. Consequently, PBMC from patients who are homozygous for the deletion mutation cannot be infected with macrophage-tropic virus and appear to be resistant to infection in vivo despite multiple exposures (12). Heterozygosity at this gene apparently correlates with a slower progression of HIV-1-related disease (6, 8, 9). Consequently, patient genotyping at this locus is important in assessing prognosis.

We have developed a rapid, sensitive, and specific genotyping assay for the human CCR5 gene. The assay utilizes isothermal amplification by NASBA of CCR5 RNA obtained from patient PBMC. Although detection and actual sequence typing of the resulting amplicons was achievable with radiolabeled probes in blot-based hybridization analysis, a technically more favorable ECL-based detection method was developed. This nonisotopic, liquid hybridization detection method involves ruthenium-labeled probes that are specific for amplicons generated from the wild-type and mutated alleles of CCR5. Hybridization results are evaluated in this system with an automated ECL reader, allowing for rapid diagnosis of NASBA products. This assay system has several advantages over other amplification-based methods which can be applied in genotyping. First, it is isothermal and does not require specialized equipment for amplification. The nucleic acids are obtained from the clinical material by the extraction method of Boom et al., which can be applied to a wide range of sample types. Second, the product of the NASBA amplification process is single-stranded RNA, which is readily analyzed by probe hybridization without the need for a denaturing step. Genotyping assays directed at DNA typically depend on the presence of only two copies of target material per cell. The NASBA assay targets RNA and therefore exploits the presence of a more abundant target material in cells where the gene is expressed.

Importantly, when the NASBA system was applied to clinical specimens (i.e., patient PBMC), the frequency of the mutated allele was found to be similar to what had been previously reported (23). The frequency of heterozygotes among individuals of western European heritage is approximately 20%. The NASBA-measured frequency in this study was also 20%. Only one individual (with a history of intravenous drug abuse) who was homozygous for the mutated allele was identified in this study. This person is the spouse of an HIV-1-infected individual and has remained HIV-1 seronegative despite frequent high-risk exposure through the sharing of needles with other HIV-1-infected individuals and through spousal heterosexual contact. Similarly, several other investigators have identified persons with the homozygous 32-bp deletion genotype who are resistant to HIV-1 infection (6, 9, 12, 17, 20-23). The fact that only one individual with the homozygous mutated genotype was found in this study is consistent with the facts that nearly all of the patients tested were HIV-1 positive and that the frequency of homozygosity in the general population is only 1% (12). Interestingly, three persons with a history of multiple exposure to HIV-1 through intravenous drug abuse, but not infected with HIV-1, demonstrated homozygous wild-type CCR5 genotypes. Additional studies are in progress to determine the nature of HIV-1 infection resistance in these persons.

Interestingly, the CCR5 NASBA genotyping assay has been used in parallel with a PCR assay directed against CCR5 DNA, and the results obtained with the two assays were 100% concordant. An advantage of the NASBA assay was the ability to perform CCR5 genotyping on a significantly lower number of PBMC than was required for the DNA PCR assay (1 × 10⁵ [NASBA] versus 2 × 10⁶ [PCR]). Although it may be possible to reconfigure the DNA PCR assay for greater sensitivity by means of an alternative detection method, the results presented here indicate greater sensitivity by the NASBA assay targeting CCR5 mRNA. Furthermore, NASBA CCR5 genotyping can be successfully performed directly on whole-blood samples, eliminating the time-consuming process of PBMC isolation (21a). Thus, NASBA technology provides a rapid, simple, and specific means for accurate genotype determination at the CCR5 locus. The clinical significance of this marker in the prognosis of HIV-1-infected patients and the ease with which this genotyping assay can be applied suggest that application of the NASBA assay on a wide scale is appropriate. Further, the NASBA assay provides an effective means for conducting population demographic studies. Moreover, NASBA technology can be applied to the detection of other relevant polymorphisms identified in the CCR5 gene (11, 13, 14), perhaps in a multiplex format. In summary, targeting the CCR5 RNA transcript with the NASBA assay system is an effective method for determining the genotype at this locus.