Previous Article | Next Article ![]()
Clinical and Diagnostic Laboratory Immunology, March 2000, p. 251-257, Vol. 7, No. 2
Department of Medical Microbiology and
Immunology, College of Medicine, University of South Florida,
Tampa, Florida 33612,1 and Division of
Infectious Diseases, Bay Pines Veterans Affairs Medical Center, Bay
Pines, Florida 335042
Received 19 July 1999/Returned for modification 17 September
1999/Accepted 12 December 1999
The 17-kDa antigen of Bartonella henselae has
previously been shown to elicit a strong humoral immune response in
patients with cat scratch disease (CSD) and to be useful in screening
human serum samples for CSD. In this study, PCR amplification of genes homologous to the 17-kDa antigen gene of B. henselae was
performed using genomic DNAs from several species of
Bartonella, including the currently recognized human
pathogens. Amplicons of similar size were demonstrated using the
following chromosomal DNA templates: B. henselae (two
strains), B. quintana (two strains), B. elizabethae, B. clarridgeiae, B. vinsonii
subsp. vinsonii, and B. vinsonii subsp.
berkhoffii. No evidence of a B. bacilliformis
homolog of the 17-kDa antigen gene was obtained using multiple primer
pairs. DNA sequencing revealed open reading frames capable of coding for proteins with sizes similar to that of the 17-kDa antigen of
B. henselae in all of the amplicons; however, extensive
sequence divergence across the genus was noted. Cloning of the
amplified products into pUC19 resulted in recombinants that directed
synthesis of homologs of the 17-kDa protein. Immunoblot analysis using
human sera from CSD cases demonstrated very little cross-reactivity among different species for this protein. In contrast, immunoblots using rabbit serum raised to the recombinant B. henselae
antigen showed extensive cross-reactivity with the proteins of other
Bartonella species. The data suggest that the use of the
17-kDa antigen as a serologic reagent may allow the development of more
specific diagnostic assays. Furthermore, the nucleotide sequences from the various versions of the 17-kDa antigen gene should be useful for
rapid identification of Bartonella at the species level.
The genus Bartonella
consists of several recognized species that were reclassified by
merging the genera Rochalimaea and Grahamella with Bartonella (11, 14). All species are
oxidase-negative, fastidious gram-negative bacilli (14).
Presently there are four species that are established human pathogens:
B. bacilliformis, B. henselae, B. quintana, and B. elizabethae (6). Recently, a newly described species, B. clarridgeiae, has been
associated with cat scratch disease (CSD) in humans (15, 28,
30). Bartonella species that have not yet been linked
to human disease include, B. vinsonii, isolated from a
Canadian vole (39); B. vinsonii subsp.
berkhoffii, isolated from dogs (13, 29); and
several species isolated from rodents (11, 20, 21). However,
a new subspecies, B. vinsonii subsp. arupensis,
was recently isolated from the blood of a single patient
(40). Specific and practical diagnostic tests have not yet
been developed for most of these species, and hence the tools necessary
to associate them with human disease do not exist.
The disease spectrum among the human pathogens ranges from severe
life-threatening infections such as the hemolytic anemia caused by
B. bacilliformis, the agent of Carrion's disease and Oroya
fever (1), to the relatively benign but common CSD caused by
B. henselae. It is estimated that annually in the United
States there are 22,000 cases of CSD contracted from domestic cats
(26). In addition, both B. henselae and B. quintana have been shown to cause more severe disease syndromes,
including fever with bacteremia, endocarditis, bacillary angiomatosis,
and peliosis hepatis, in both immunocompromised and immunocompetent
patients (6, 37). In one case a novel bacterium, B. elizabethae, was isolated from a 31-year-old man with aortic
tissue vegetation (17); however, additional reports linking
this organism to human disease have not been published.
Diagnosis of Bartonella infection is most frequently
accomplished by serology. Isolation is possible but requires extended incubation periods far greater than are needed for most bacteria. Extended incubation times and fastidious growth requirements result in
low sensitivity associated with isolation and problems with contamination of primary plating media (6). PCR is an option in laboratories with the proper equipment and expertise but has not yet
gained widespread use in clinical diagnostic laboratories (7). For these reasons as well as convenience, serology
remains the most frequently utilized means of diagnosis. Serologic
assays are simple and easy to perform, but currently used methods only confirm exposure and do not conclusively indicate an acute infection (6). The indirect fluorescent-antibody assay (IFA) is the
most common and thoroughly evaluated serologic test (2, 9, 16, 33,
35, 41). However, cross-reactivity among Bartonella species (23, 27) and variable sensitivities observed for the IFA in different laboratories have led some investigators to question the usefulness of this test (2, 9, 33). To address these concerns, we have focused on identifying and characterizing protein antigens of the various Bartonella species that may be of
value as diagnostic reagents. One such protein, the 17-kDa antigen, was
identified from B. henselae (5). The reactivity
of a recombinant fusion protein derived from the 17-kDa antigen of
B. henselae in a Western blot format was shown to correlate
well with IFA results and diagnosis of CSD (5). The focus of
this study is to identify homologs of the 17-kDa protein in other
species of Bartonella. Recombinant versions of these
proteins should prove useful for serodiagnosis, and the corresponding
genes may be of value as targets for species-specific amplification.
Bacterial strains and preparation of genomic DNA.
The
sources and designations of the various isolates, representing six
species of Bartonella, used in this study are summarized in
Table 1. Bacteria were cultivated on
heart infusion agar supplemented with 5% defibrinated rabbit blood at
37°C in 5% CO2. Cultures were incubated for 3 to 5 days
until growth was sufficient. B. bacilliformis was cultivated
at 28°C without supplemental CO2 for 7 to 10 days. Colony
morphology and staining of bacterial cells by the Gimenez procedure
(18) were used to monitor cell growth and purity. DNA was
extracted using a procedure previously described (3).
Briefly, cell growth was harvested into sterile TE buffer (10 mM Tris
[pH 8.0] and 1 mM EDTA). Sodium lauryl sarcosinate was added to a
final concentration of 1.0%, and proteinase K was added to a final
concentration of 100 µg/ml. After 2 h of incubation at 65°C,
the bacterial lysate was repeatedly extracted with an equal volume of
buffer-saturated phenol and chloroform. DNA was precipitated by the
addition of 1/10 volume of 3 M sodium acetate and 2.5 volumes of cold
ethanol. The yield and size of the genomic DNA were assessed by agarose
gel electrophoresis.
1071-412X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Conservation of the 17-Kilodalton Antigen Gene
within the Genus Bartonella
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Properties of the 17-kDa antigen homologs from different
Bartonella spp.
PCR amplification of the 17-kDa antigen gene homologs.
Genomic DNAs from the species listed in Table 1 were used as a template
for PCR. Multiple primer pair combinations were constructed from
regions surrounding the B. henselae (Houston-1) 17-kDa
antigen gene; however, four different primer pair combinations were
shown to be optimal and were used to amplify each template as follows. B. clarridgeiae was amplified with primer pair 17KAF
(5' GGAATGAATGATGAGATCGC 3') and 17KBR (5'
GTTGAGAAGACTATTCATCG-3'). B. quintana and B. henselae, were amplified with primer pair 240 (5'
GCTCTAGACAGGGACAAAGTTCCGTTGTTGC 3') and 241 (5'-CGGGGTACCGCCATTGTCGTCACAATGACG 3'). B. elizabethae and B. vinsonii subsp. vinsonii
were amplified with primer pair 17KAF and R2 (5'
TGAAAAGAGGTCCAAGACCT 3'). B. vinsonii subsp. berkhoffii was amplified with primer pair 17KBR (5'
CTGAGCGAGAATTTGAGCTG 3') and 17KAR (5' CCAGAAATGCTCTCAAACGG
3'). The positions of these primers are indicated in Fig.
1. An additional primer pair derived from
highly conserved sequences internal to the 17-kDa antigen gene,
consisting of IntF (5' GAAAAAATATAGCTTAGTCAC 3') and IntR (5'CTAAAGTCGGACATCAGATT 3'), was also used to confirm the
presence of a 17-kDa antigen gene homolog in all of the
Bartonella species that tested positive. Amplification was
performed using the following conditions: 94°C for 2 min, followed by
30 cycles of 94°C for 1 min, 50°C for 2 min, and 70°C for 2 min.
The last cycle was followed by incubation at 70°C for 7 min to ensure
the adenylation of the 3' end. PCR amplifications were performed in a
DNA thermocycler (MJ Research, Watertown, Mass.) using EasyStart 100 prealiquoted tubes (Molecular BioProducts, Inc., San Diego, Calif.).
|
Cloning.
Amplicons were cloned directly from the PCR mixture
or following gel extraction into pCR2.1-TOPO according to the
directions of the manufacturer (Invitrogen, Carlsbad, Calif.). The
ligation junction of pCR2.1 is located between two EcoRI
cleavage sites. The resulting ligation mixture was transformed into One
Shot cells (Invitrogen) and plated on Luria-Bertani (LB) agar
containing ampicillin (100 µg/ml) and 80 µl of X-gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) at 20 mg/ml. White colonies were selected and cultured overnight in LB broth
with ampicillin. Plasmid DNA was isolated by alkaline lysis and cleaved
with EcoRI, and the insert size was confirmed by agarose gel electrophoresis.
DNA sequencing. Plasmid DNA was isolated using the standard protocol from a QIAprep Spin Plasmid Kit (Qiagen Inc., Valencia, Calif.). Clones representing each strain were manually sequenced by a modification (42) of the dideoxy chain termination method of Sanger et al. (36). The resulting denatured double-stranded plasmid was sequenced using a Sequenase Quick-Denature Plasmid Sequencing Kit according to the directions of the manufacturer (Amersham Life Science, Cleveland, Ohio). 35S-dATP-labeled sequencing reaction mixtures were electrophoresed on a 6% acrylamide gel. The dried gel was exposed to X-ray film, and the sequence was recorded. Analysis of DNA sequences was performed using DNAsis version 2.5 for Windows (Hitachi, San Bruno, Calif.).
PCR amplification for ligation into pUC19.
Specific
oligonucleotide pairs derived from the sequence obtained from each
species were synthesized in order to amplify the entire 17-kDa gene
with the putative ribosome binding site from each individual
Bartonella strain. Each oligonucleotide primer derived from
the 5' end of the gene was designed with an XbaI site
(-TCTAGA-) near the 5' end, and the primer derived from the 3' end of the gene contained a BamHI site (-GGATCC-)
near the 5' end to allow directional cloning. Amplification was
achieved through initial denaturation at 94°C for 4 min; 3 cycles of
94°C for 1 min, 42°C for 2 min, and 67°C for 2 min; and 30 cycles
of 94°C for 1 min, 50°C for 2 min, and 70°C for 1 min 30 s.
Each amplicon was digested with XbaI and BamHI
and ligated into pUC 19 cleaved with the same two enzymes so that the
17-kDa antigen gene homologs were immediately downstream of the
inducible lacZ
-peptide promoter. The ligation mixtures
were transformed into E. coli JM109 as previously described
(19), and clones to be used for expression were identified
by restriction endonuclease analysis and agarose gel electrophoresis.
All recombinants were sequenced again using fluorescent-dye-labeled
primers with a Thermosequenase cycle sequencing kit (Amersham) and an
automated DNA sequencing and genetic analysis system (Li-Cor Inc.,
Lincoln, Nebr.).
SDS-PAGE and immunoblotting.
Clones were grown to early log
phase at 37°C in 5 ml of LB broth containing ampicillin (100 µg/ml)
and induced with 1 mM isopropyl thio-
-D-galactopyranoside (IPTG) for an additional
3.5 h. Bacterial cells were harvested by centrifugation and
resuspended in one-third of the original culture volume of 1× sample
buffer (63 mM Tris [pH 6.8], 10% glycerol, 2% sodium dodecyl
sulfate [SDS], 0.0025% bromophenol blue) (Novex, San Diego, Calif.),
and
-mercaptoethanol was added to a final concentration of 1%. The
samples were boiled for 5 min and subjected to SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) using a 4 to 20% gradient minigel (Novex).
MultiMark multicolored standards were used to determine the approximate molecular weight (Novex). The proteins were transferred to
nitrocellulose and blocked overnight in Tris-buffered saline (TBS) with
5% skim milk. The resulting membrane filter was incubated with serum
diluted 1:200 (human sera) or 1:300 (rabbit serum) in TBS-5% skim
milk for 2 h. The membrane filter was washed in TBS with 0.05%
Tween 20 four times and exposed to either peroxidase-labeled goat
anti-rabbit affinity-purified antibodies (Kirkegaard and Perry,
Gaithersburg, Md.; diluted 1:7,000 in TBS with 5% skim milk) or
peroxidase-labeled goat anti-human affinity purified antibodies
(Kirkegaard and Perry; diluted 1:5,000 in TBS with 5% skim milk). The
filter was then washed, and bound antibody was detected with TMB
membrane substrate according to directions of the manufacturer
(Kirkegaard and Perry).
In vitro transcription-translation. Plasmid template was used in an in vitro transcription-translation reaction designed for circular prokaryotic templates (Promega, Madison, Wis.). Plasmid-encoded proteins were labeled with [35S]methionine and resolved on a 4 to 20% gradient gel (Novex). The resulting gel was exposed to Enhance autoradiography enhancer (NEN Life Science Products, Boston, Mass.), dried, and exposed to X-ray film.
Nucleotide sequence accession numbers. The nucleotide sequence for the 17-kDa antigen gene of B. henselae has been previously published (5) and deposited in the GenBank database under accession number U23447. The accession numbers for the genes from other strains of Bartonella are as follows: B. henselae (San Antonio-1), AF199503; B. quintana (Fuller), AF199006; B. quintana (U.Mass), AF199007; B. elizabethae, AF195504; B. clarridgeiae, AF195506; B. vinsonii subsp. vinsonii, AF195505; and B. vinsonii subsp. berkhoffii, AF200337.
| |
RESULTS |
|---|
|
|
|---|
PCR amplification. PCR amplification of templates from various Bartonella species resulted in products of the approximate predicted size from B. henselae (San Antonio-1 strain), B. clarridgeiae, B. quintana (Fuller strain), B. quintana (U.Mass strain), B. vinsonii subsp. vinsonii, B. vinsonii subsp. berkhoffii, and B. elizabethae with one or more primer pairs. The primer pairs which provided the best amplification for subsequent cloning and sequencing are described in Materials and Methods. B. bacilliformis produced small amounts of a PCR product that was much larger than predicted for a homolog of the 17-kDa antigen gene using primer pairs 17KAF-17KAR, 17KAF-17KBR, and 240-241. Sequencing of clones harboring these amplicons resulted in the identification of an open reading frame capable of coding for a protein of 18 kDa. However, despite the similarity in predicted size with the 17-kDa antigen, no obvious amino acid sequence identity was observed. In an additional experiment utilizing primers internal to the most highly conserved coding regions of the 17-kDa antigen gene (IntF and IntR), product was amplified from all Bartonella species tested except B. bacilliformis (data not shown). Thus, despite the use of multiple primer pairs for amplification, no evidence of a 17-kDa antigen gene was found for either strain of B. bacilliformis.
Sequence analysis. DNA sequencing revealed open reading frames capable of coding for proteins with deduced sizes similar to that previously described for the B. henselae 17-kDa antigen. Proteins of similar sizes were predicted from the sequence obtained from B. henselae (San Antonio-1 strain). B. quintana (Fuller strain and U.Mass strain), B. clarridgeiae, and B. vinsonii subsp. berkhoffii (Table 1). However, the B. vinsonii subsp. vinsonii and B. elizabethae versions of the gene were substantially larger (Table 1). Thus, there seems to be some discontinuity in predicted size among the various species, including both a human pathogen (B. elizabethae) and a strain currently thought to be nonpathogenic for humans (B. vinsonii subsp. vinsonii).
All homologs of the gene exhibited certain characteristics of prokaryotic gene structure. The antigen genes from B. henselae (San Antonio), B. clarridgeiae, B. quintana (Fuller), B. quintana (U.Mass.), B. vinsonii subsp. vinsonii, B. vinsonii subsp. berkhoffii, and B. elizabethae contained the identical polypurine-rich sequence (AGGAG) immediately upstream of the presumed ATG initiator methionine codon. These sequences presumably serve as ribosome binding sites for the antigen genes from the various species and strains. Similar sequences have been found immediately upstream of other B. henselae genes (4, 5, 12; A.W.O. Burgess, J.-Y. Paquet, and J.-J. Letesson, and B. Anderson, submitted for publication). The putative initiator methionine is followed by a stretch of 18 to 25 residues that define a hydrophobic domain in all of the species that were analyzed using the algorithm of Hopp and Woods (24). In addition, two lysine codons follow the methionine start codon in all species. These properties are strongly predictive of bacterial signal peptides involved in targeting proteins for translocation across the cytoplasmic membrane (25). The deduced amino acid sequence alignment for B. henselae (San Antonio-1), B. vinsonii subsp. berkhoffii, and B. clarridgeiae indicates potential A-X-A peptidase cleavage sites (Fig. 2). Identical sequences have been shown on two other proteins of B. henselae that are processed and cleaved by signal peptidase before insertion into the outer membrane (12; Burgess and Anderson, submitted). Likewise, similar or identical peptide sequences have been shown to function as signal peptidase cleavage sites in E. coli (25). The other species revealed potential cleavage site variations that are similar to sites reported for E. coli, differing at one position from the consensus sequence of A-X-A (25): T-I-A, B. quintana (Fuller); T-I-A, B. quintana (U.Mass); A-F-S, B. elizabethae; and S-M-A, B. vinsonii subsp. vinsonii.
|
|
Expression and antigenicity of the 17-kDa antigen homologs.
Immunoblot analysis with polyclonal anti-17-kDa rabbit serum
demonstrated reactivity with clones of the antigen genes from B. henselae (Fig. 4, lanes B and C),
B. clarridgeiae (lane D), and B. quintana (lanes
E and F). These clones produce a doublet band with a size identical to
that of the 17-kDa antigen from the Houston-1 strain of B. henselae. It is likely that the sources of the two bands seen in
the doublet are proteins that are cleaved to various degrees by
E. coli signal peptidase. An additional band is seen with
B. henselae and B. clarridgeiae at approximately 28 kDa (Fig. 4, lanes B to D); it is possible that this protein is
either incompletely solubilized (denatured) 17-kDa antigen or a dimer
of the protein. It should be noted that only the B. henselae
and B. clarridgeiae genes produced the 28-kDa band in E. coli, suggesting that some intrinsic variation of these
versions of the protein results in the slower-migrating form of the
antigen. Unlike those of the other Bartonella species, the
B. elizabethae version of the antigen migrated at
approximately 21 kDa (Fig. 4, lane H). The two subspecies of B. vinsonii failed to show any obvious immunoreactive bands at any
size (Fig. 4, lanes G and I). When the DNAs from the recombinant
E. coli strains harboring the genes derived from the two
subspecies of B. vinsonii were used as templates in in vitro
transcription-translation reactions, both plasmids directed synthesis
of proteins of the predicted size (data not shown). Thus, these
proteins are expressed in E. coli but are not reactive with
the rabbit anti-B. henselae 17-kDa antigen serum.
Cross-reactive rabbit antibodies are observed to react with bands at
other sizes but are also reactive with the E. coli-plus-vector control (Fig. 4, lane A), indicating they are
E. coli proteins. These data indicate that epitope(s)
recognized by the immunized rabbit is conserved in some but not all
species of Bartonella.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Human infection by B. henselae and B. quintana results in a diverse array of clinical symptoms. Laboratory diagnosis of infections caused by these two agents requires isolation and identification, PCR amplification of bacterial DNA, or the presence of specific antibodies detected by serology. Only serologic testing is widely available, and it remains the most common means of diagnosing infections caused by Bartonella species. Several serologic assays have been described for detecting specific antibodies, including enzyme-linked immunosorbent assay (8, 23, 38) and IFA (35). Of these the IFA is the most widely used and thoroughly evaluated test (16). However, recent reports have indicated that the predictive value of the IFA may vary among different investigators (2, 9, 16, 33, 41). Variable results and sensitivities of this test have resulted in reports questioning the use of the IFA for diagnosis (9). The cause of such variability is not known, but it may be due to different methods of antigen preparation. Likewise, cross-reactivity between Bartonella and Coxiella, Chlamydia, and other bacteria has been well documented (23, 27). It is also known that the IFA is not specific for individual Bartonella species, with a patient's serum usually being reactive with antigens from one or more Bartonella species by IFA (6).
B. quintana appears to be a common pathogen both in the United States and abroad, and B. elizabethae and B. clarridgeiae have been associated with human disease (6). A number of other Bartonella species, subspecies, and strain variants have been associated with rodents, providing a common potential reservoir for transmission. In addition, B. vinsonii subsp. vinsonii and B. vinsonii subsp. berkhoffii have been identified as being capable of causing diseases of veterinary importance. Standardized antigens for serologic testing to detect specific antibodies to many of these Bartonella species have not been described. By characterizing individual protein antigens of various Bartonella species, we may be able to identify antigens or epitopes specific for each of the Bartonella species that are more specific than current serologic tests.
To investigate the humoral immune response to Bartonella
infection, we have focused on individual protein antigens. One such antigen, the 17-kDa antigen of B. henselae, has been
expressed as a fusion protein and shown to be reactive with sera from
92% of the CSD cases tested, suggesting that it may be of value as a
diagnostic reagent (5). A homologous version of this antigen was found in all species of Bartonella tested except
B. bacilliformis. The nucleotide sequence and the
corresponding deduced amino acid sequence shared various levels of
homology among the species tested (Fig. 2). However, the first 4 amino
acids (MKKY) were identical for all species, and the first 20 residues
were similar with regard to overall hydrophobicity and charge. The
hydrophobicity and presence of lysine residues at the immediate amino
terminus are characteristic of translocated proteins of bacteria. The
lysines are thought to interact with the phosphate groups of the
membrane phospholipids, and the hydrophobic core domain is thought to
interact with the lipid moieties (25). The hydrophobic core
is followed by a potential signal peptidase cleavage site. Alanine is
frequently found at the
3 and
1 positions upstream of the cleavage
site in E. coli (25) and was found in the
B. henselae and B. elizabethae antigens in this
study. Other small neutral side chains, such as glycine, serine, and
threonine, are often seen in these positions (25), which was
consistent with findings for B. quintana (Fuller and U.Mass), B. elizabethae, and B. vinsonii subsp.
vinsonii. The signal sequence of A-X-A has been shown by our
laboratory to be a signal peptidase cleavage site for two other outer
membrane proteins of B. henselae (12;
Burgess and Anderson, submitted). The presence of doublet bands on the
immunoblots is also consistent with the role of signal peptidase in
processing this antigenic protein. Thus, it is likely that the proteins
from each of the Bartonella species included in this study
are translocated across the cytoplasmic membrane.
The deduced amino acid sequences were used to construct a dendrogram of phylogenetic relationships. Surprisingly, the two species that were the most closely related were B. henselae and B. clarridgeiae (84.5%). The B. henselae and B. quintana versions of the 17-kDa antigen showed extensive sequence divergence (>30%), and no variation for different strains within B. henselae (Houston-1 and San Antonio-1 strains) and B. quintana (Fuller and U.Mass strains) was noted. In contrast, the two subspecies of B. vinsonii produced vastly different deduced amino acid sequences with extensive sequence divergence for the antigen (45.6%). It is possible that these two subspecies are more remotely related than previously thought (29), or, alternatively, that genetic exchange involving the 17-kDa antigen gene has hastened the evolutionary process.
When the cloned versions of the 17-kDa antigen from each of the species were reacted with human serum samples from patients with Bartonella infections, only B. henselae and the B. clarridgeiae were reactive. These data are also consistent with the phylogenetic relationship showing that the antigen is more closely related between B. henselae and B. clarridgeiae than any two other species. These results also suggest that the epitope(s) recognized by human sera from patients infected with B. henselae is not cross-reactive with B. quintana; however, since isolation from the patients whose sera were used in this study was not attempted, this observation cannot be confirmed. If this lack of cross-reactivity is confirmed upon further evaluation, recombinant 17-kDa antigens could be used to differentiate infections caused by B. henselae and B. clarridgeiae from those caused by B. quintana. Since B. henselae and B. clarridgeiae are associated with CSD and B. quintana is more frequently associated with severe systemic disease, identification of B. quintana as a causative agent may indicate the need for more aggressive treatment with antibiotics that are not always prescribed for CSD. The rabbit serum raised to purified recombinant B. henselae 17-kDa protein was broadly cross-reactive with all species except B. vinsonii, showing that at least one epitope recognized by the rabbit serum is well conserved.
The identification and sequencing of homologs of the 17-kDa antigen should facilitate the development of both serologic and genetic tools for the diagnosis of Bartonella infections. The use of recombinant protein derived from each of the pathogenic species of Bartonella as an antigen for enzyme-linked immunosorbent assay should permit rapid serologic testing that discriminates infections caused by B. henselae from those caused by B. quintana. If the need arises for serologic assays that are specific for other Bartonella species, then it should be possible to utilize the appropriate 17-kDa antigen homolog as an antigen. Additionally, the use of conserved antigen genes as targets for gene probes and PCR primers has proven useful for rapid detection and identification of bacteria directly in clinical specimens or clinical isolates. Currently, the species level identification of Bartonella isolates is often based on PCR amplification of conserved genes followed by the use of specific probes (7) or restriction fragment length polymorphism analysis (10, 32). The use of PCR primers derived from segments of the 17-kDa antigen gene which are unique to each species could easily shorten and simplify this process.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dorsey Kordick of North Carolina State University for providing the strains of B. clarridgeiae and B. vinsonii and Gary Litman, All Children's Hospital, for automated sequencing services. We are also greatly appreciative of Pat Emmanuel, USF Department of Pediatrics, for providing the serum sample from a clinically diagnosed case of CSD.
This research was supported by Public Health Service grant R29-AI38178 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Medical Microbiology and Immunology, College of Medicine, MDC10, University of South Florida, 12901 Bruce B. Downs Blvd., Tampa, FL 33612. Phone: (813) 974-2109. Fax: (813) 974-4151. E-mail: dsweger{at}com1.med.usf.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alexander, B. 1995. A review of Bartonellosis in Ecuador and Columbia. Am. J. Trop. Med. Hyg. 52:354-359. |
| 2. |
Amerein, M. P.,
D. De Breil,
B. Jaulhac,
P. Meyer,
H. Monteil, and Y. Piemont.
1996.
Diagnostic value of the indirect immunofluorescence assay in cat scratch disease with Bartonella henselae and Afipia felis antigens.
Clin. Diagn. Lab. Immunol.
3:200-204 |
| 3. | Anderson, B., C. Goldsmith, A. Johnson, I. Padmalayam, and B. Baumstark. 1994. Bacteriophage-like particle of Rochalimaea henselae. Mol. Microbiol. 13:67-73[CrossRef][Medline]. |
| 4. | Anderson, B., D. Jones, and A. Burgess. 1996. Cloning, expression and sequence analysis of the Bartonella henselae gene encoding the HtrA stress-response protein. Gene 178:35-38[CrossRef][Medline]. |
| 5. |
Anderson, B.,
E. Lu,
D. Jones, and R. Regnery.
1995.
Characterization of a 17-kilodalton antigen of Bartonella henselae reactive with sera from patients with cat scratch disease.
J. Clin. Microbiol.
33:2358-2365 |
| 6. |
Anderson, B., and M. A. Neuman.
1997.
Bartonella spp. as emerging human pathogens.
Clin. Microbiol. Rev.
10:203-219 |
| 7. |
Anderson, B.,
K. Sims,
R. Regnery,
L. Robinson,
M. J. Schmidt,
S. Goral,
C. Hager, and K. Edwards.
1994.
Detection of Rochalimaea henselae DNA in specimens from cat scratch disease patients by PCR.
J. Clin. Microbiol.
32:942-948 |
| 8. | Barka, N. E., T. Hadfield, M. Patnaik, W. A. Schwartzman, and J. B. Peter. 1993. EIA for detection of Rochalimaea henselae-reactive IgG, IgM, and IgA antibodies in patients with suspected cat-scratch disease. J. Infect. Dis. 167:1503-1504[Medline]. |
| 9. | Bergmans, A. M., M. F. Peeters, J. F. Schellekens, M. C. Vos, L. J. Sabbe, J. M. Ossewaarde, H. Verbakel, H. J. Hooft, and L. M. Schouls. 1997. Pitfalls and fallacies of cat scratch disease serology: evaluation of Bartonella henselae-based indirect fluorescence assay and enzyme-linked immunoassay J. Clin. Microbiol. 35:1931-1937. |
| 10. | Birtles, R. J. 1995. Differentiation of Bartonella species using restriction endonuclease analysis of PCR-amplified 16S rRNA genes. FEMS Microbiol. Lett. 129:261-265[Medline]. |
| 11. |
Birtles, R. J.,
T. G. Harrison,
N. A. Saunders, and D. H. Molyneux.
1995.
Proposals to unify the genera Grahamella and Bartonella, with descriptions of Bartonella talpae comb. nov., Bartonella peromysci comb. nov., and three new species, Bartonella grahamii sp. nov. Bartonella taylorii sp. nov., and Bartonella doshiae sp. nov.
Int. J. Syst. Bacteriol.
45:1-8 |
| 12. | Bowers, T. J., D. Sweger, D. Jue, and B. Anderson. 1998. Isolation, sequencing, and expression of the gene encoding a major protein from the bacteriophage associated with Bartonella henselae. Gene 206:49-52[CrossRef][Medline]. |
| 13. |
Breitschwerdt, E. B.,
D. L. Kordick,
D. E. Malarkey,
B. Keene,
T. L. Hadfield, and K. Wilson.
1995.
Endocarditis in a dog due to infection with a novel Bartonella subspecies.
J. Clin. Microbiol.
33:154-160 |
| 14. |
Brenner, D. J.,
S. P. O'Connor,
H. H. Winkler, and A. G. Steigerwalt.
1993.
Proposals to unify the genera Bartonella and Rochalimaea, with descriptions of Bartonella quintana comb. nov. Bartonella vinsonii comb. nov., Bartonella henselae comb. nov., and Bartonella elizabethae comb. nov., and to remove the family Bartonellaceae from the order Rickettsiales.
Int. J. Syst. Bacteriol.
43:777-786 |
| 15. |
Clarridge, J. E.,
T. J. Raich,
D. Pirwani,
B. Simon,
L. Tsai,
M. C. Rodriguez-Barradas,
R. Regenery,
A. Zollo,
D. C. Jones, and C. Rambo.
1995.
Strategy to detect and identify Bartonella species in routine clinical laboratory yields Bartonella henselae from human immunodeficiency virus-positive patient and unique Bartonella strain from his cat.
J. Clin. Microbiol.
33:2107-2113 |
| 16. |
Dalton, M. J.,
L. E. Robinson,
J. Cooper,
R. L. Regnery,
J. G. Olson, and J. E. Childs.
1995.
Use of Bartonella antigens for serologic diagnosis of cat-scratch disease at a national reference center.
Arch. Intern. Med.
155:1670-1676 |
| 17. |
Daly, J. S.,
M. G. Worthington,
D. J. Brenner,
C. W. Moss,
D. G. Hollis,
R. S. Weyant,
A. G. Steigerwalt,
R. E. Weaver,
M. I. Daneshvar, and S. P. O'Connor.
1993.
Rochalimaea elizabethae sp. nov. isolated from a patient with endocarditis.
J. Clin. Microbiol.
31:872-881 |
| 18. | Gimenez, D. F. 1964. Staining rickettsiae in yolk-sac cultures. Stain Technol. 39:135-140[Medline]. |
| 19. | Hanahan, D. 1985. Techniques for transformation of E. coli, p. 109-136. In D. M. Glover (ed.), DNA cloning: a practical approach, vol. 1. IRL Press, Oxford, United Kingdom. |
| 20. |
Heller, R.,
P. Riegel,
Y. Hansmann,
G. Delacour,
D. Bermond,
C. Dehio,
F. Lamarque,
H. Monteil,
B. Chomel, and Y. Piemont.
1998.
Bartonella tricoborum sp. nov., a new Bartonella species isolated from the blood of wild rats.
Int. J. Syst. Bacteriol.
48:1333-1339 |
| 21. |
Heller, R.,
M. Kubina,
P. Mariet,
P. Riegel,
G. Delacour,
C. Dehio,
R. Kasten,
H. J. Boulouis,
H. Monteil,
B. Chomel, and Y. Piemont.
1999.
Bartonella alsatica sp. nov., a new Bartonella species isolated from the blood of wild rabbits.
Int. J. Syst. Bacteriol.
49:283-288 |
| 22. | Higgins, D. G., and P. M. Sharp. 1988. CLUSTAL: a package for performing multiple sequence alignments on a microcomputer. Gene 73:237-244[CrossRef][Medline]. |
| 23. | Hollingdale, M. R., J. E. Herrmann, and J. W. Vinson. 1978. Enzyme immunoassay of antibody to Rochalimaea quintana: diagnosis of trench fever and serologic cross-reactions among other rickettsiae. J. Infect. Dis. 137:578-582[Medline]. |
| 24. |
Hopp, T. P., and K. R. Woods.
1981.
Prediction of antigenic determinants from amino acid sequences.
Proc. Natl. Acad. Sci. USA
78:3824-3828 |
| 25. | Izard, J. W., and D. A. Kendall. 1994. Signal peptides: exquisitely designed transport promoters. Mol. Microbiol. 13:765-773[CrossRef][Medline]. |
| 26. |
Jackson, L. S.,
B. A. Perkins, and J. D. Wenger.
1993.
Cat scratch disease in the United States: an analysis of three national databases.
Am. J. Public Health
83:1707-1711 |
| 27. | Knobloch, J., R. Bialek, G. Muller, and P. Asmus. 1988. Common surface epitope of Bartonella bacilliformis and Chlamydia psittaci. Am. J. Trop. Med. Hyg. 39:427-433. |
| 28. |
Kordick, D. L.,
E. J. Hilyard,
T. L. Hadfield,
K. H. Wilson,
A. G. Steigerwalt,
D. J. Brenner, and E. B. Breitschwerdt.
1997.
Bartonella clarridgeiae, a newly recognized zoonotic pathogen causing inoculation papules, fever, and lymphadenopathy (cat scratch disease).
J. Clin. Microbiol.
35:1813-1818 |
| 29. |
Kordick, D. L.,
B. Swaminathan,
C. E. Greene,
K. H. Wilson,
A. M. Whitney,
S. O'Connor,
D. G. Hollis,
G. M. Matar,
A. G. Steigerwalt,
G. B. Malcolm,
P. S. Hayes,
T. L. Hadfield,
E. B. Breitschwerdt, and D. J. Brenner.
1996.
Bartonella vinsonii subsp. berkhoffii subsp. nov., isolated from dogs; Bartonella vinsonii subsp. vinsonii; and emended description of Bartonella vinsonii.
Int. J. Syst. Bacteriol.
46:704-709 |
| 30. | Lawson, P. A., and M. D. Collins. 1996. Description of Bartonella clarridgeiae sp. nov. isolated from the cat of a patient with Bartonella henselae septicemia. Med. Microbiol. Lett. 5:64-73. |
| 31. | Lucey, D., M. J. Dolan, C. W. Moss, M. Garcia, D. G. Hollis, S. Wenger, G. Morgan, R. Almeida, D. Leong, K. S. Greisen, D. F. Welch, and L. N. Slater. 1992. Relapsing illness due to Rochalimaea henselae in immunocompetent hosts: implication for therapy and new epidemiological associations. Clin. Infect. Dis. 14:683-688[Medline]. |
| 32. |
Norman, A. F.,
R. Regnery,
P. Jameson,
C. Greene, and D. C. Krause.
1995.
Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene.
J. Clin. Microbiol.
33:1797-1803 |
| 33. | Raoult, D., H. T. Dupont, and M. Enea-Mutillod. 1994. Positive predictive value of Rochalimaea henselae antibodies in the diagnosis of cat-scratch disease. Clin. Infect. Dis. 19:335. |
| 34. |
Regnery, R. L.,
B. E. Anderson,
J. E. Clarridge III,
M. Rodriquez-Barradas,
D. C. Jones, and J. H. Carr.
1992.
Characterization of a novel Rochalimaea species, R. henselae sp. nov., isolated from blood of a febrile, human immunodeficiency virus-positive patient.
J. Clin. Microbiol.
30:265-274 |
| 35. | Regnery, R. L., J. G. Olson, B. A. Perkins, and W. Bibb. 1992. Serologic response to "Rochalimaea henselae" antigen in suspected cat scratch disease. Lancet 339:1443-1445[CrossRef][Medline]. |
| 36. | Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 76:5463-5467. |
| 37. |
Slater, L. N.,
D. F. Welch, and K.-W. Min.
1992.
Rochalimaea henselae causes bacillary angiomatosis and peliosis hepatis.
Arch. Intern. Med.
152:602-606 |
| 38. |
Szelc-Kelly, C. M.,
S. Goral,
G. I. Perez-Perez,
B. Perkins,
R. L. Regnery, and K. M. Edwards.
1995.
Serologic response to Bartonella and Afipia antigens in patients with cat scratch disease.
Pediatrics
96:1137-1142 |
| 39. |
Weiss, E., and G. A. Dasch.
1982.
Differential characteristics of strains of Rochalimaea: Rochalimaea vinsonii sp. nov., the Canadian vole agent.
Int. J. Syst. Bacteriol.
32:305-314 |
| 40. |
Welch, D. F.,
K. C. Carroll,
E. K. Hofmeister,
D. H. Persing,
D. A. Robison,
A. G. Steigerwalt, and D. J. Brenner.
1999.
Isolation of a new subspecies, Bartonella vinsonii subsp. arupensis, from a cattle rancher: identity with isolates found in conjunction with Borrelia burgdorferi and Babesia microti among naturally infected mice.
J. Clin. Microbiol.
37:2598-2601 |
| 41. |
Zangwill, K. M.,
D. H. Hamilton,
B. A. Perkins,
R. L. Regnery,
B. D. Plikaytis,
J. L. Hadler,
M. L. Cartter, and J. D. Wenger.
1993.
Cat scratch disease in Connecticut: epidemiology, risk factors and evaluation of a new diagnostic test.
N. Engl. J. Med.
329:8-13 |
| 42. |
Zhang, H.,
R. Scholl,
J. Browse, and C. Somerville.
1998.
Double stranded DNA as a choice for DNA sequencing.
Nucleic Acids Res.
16:1220 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»