Previous Article | Next Article ![]()
Clinical and Diagnostic Laboratory Immunology, May 2001, p. 545-551, Vol. 8, No. 3
Unité d'Immuno-Allergie Alimentaire
INRA-CEA, Service de Pharmacologie et d'Immunologie, Bat 136 CEA
Saclay, 91191 Gif sur Yvette,1 and
Unité de Recherches Laitières et de
Génétique Appliquée2 and
Unité d'Ecologie et de Physiologie du Système
Digestif,3 INRA, 78352 Jouy en Josas, France
Received 30 May 2000/Returned for modification 19 September
2000/Accepted 6 February 2001
The bovine beta-lactoglobulin (BLG) is a major cow's milk
allergen. Here, we evaluated the immune response against BLG induced in
mice, using the organism Lactococcus lactis, which has
GRAS ("generally regarded as safe") status, as a delivery vehicle. The cDNA of the blg gene, encoding BLG, was expressed
and engineered for either intra- or extracellular expression in
L. lactis. Using a constitutive promoter, the yield of
intracellular recombinant BLG (rBLG) was about 20 ng per ml of culture.
To increase the quantity of rBLG, the nisin-inducible expression system
was used to produce rBLG in the cytoplasmic and extracellular
locations. Although the majority of rBLG remained in the cytoplasm, the
highest yield (2 µg per ml of culture) was obtained with a secreting
strain that encodes a fusion between a lactococcal signal peptide and rBLG. Whatever the expression system, the rBLG is produced mostly in a
soluble, intracellular, and denatured form. The BLG-producing strains
were then administered either orally or intranasally to mice, and the
immune response to BLG was examined. Specific anti-BLG immunoglobulin A
(IgA) antibodies were detected 3 weeks after the immunization protocol
in the feces of mice immunized with the secreting lactococcal strain.
Specific anti-BLG IgA detected in mice immunized with lactococci was
higher than that obtained in mice immunized with the same quantity of
pure BLG. No specific anti-BLG IgE, IgA, IgG1, or IgG2a was detected in
sera of mice. These recombinant lactococcal strains constitute good
vehicles to induce a mucosal immune response to a model allergen and to better understand the mechanism of allergy induced by BLG.
The gastrointestinal tract is
constantly exposed to substantial amounts of food and bacterial
components. In the healthy gut, the immune system is able to create a
balance between mucosal immunity and systemic tolerance. In food
allergy, this balance is impaired and oral tolerance to dietary antigen
is not achieved or maintained (14, 19, 29). Cow's milk
allergy is an important problem in infants because it affects 1.9 to
2.8% of infants in the first 2 years of life in various countries of
northern Europe (17, 18). Beta-lactoglobulin (BLG) is the
most abundant protein of the whey fraction of milk and is regarded as a
dominant allergen together with casein (37). In our
laboratory, we use BLG as a model protein to evaluate and modulate the
immune response to a food allergen in mice, and we have produced both
anti-BLG monoclonal antibodies (MAb) (25) and recombinant
BLG in Escherichia coli (8). Moreover, the BLG
structure is well documented (27); it is a 162-amino-acid
globular protein which contains two intramolecular disulfide bonds. In
this study, we produced BLG in Lactococcus lactis, a
food-grade bacterium, and used these recombinant strains to measure a
potential specific immune response after intranasal or oral
administration in mice.
L. lactis is a gram-positive lactic acid bacterium that is
nonpathogenic, noninvasive, and noncolonizing and that has
GRAS ("generally regarded as safe") status. Its use as a
vaccine delivery system (for a review, see reference 39)
using tetanus toxin fragment C (TTFC) (40) has been
previously reported. Parenteral, intranasal, or oral vaccination of
mice with recombinant L. lactis can elicit levels of
systemic serum Ab against tetanus toxin which protect against
subsequent challenge with otherwise lethal quantities of tetanus toxin
(26, 28, 40). Considering its potential as an antigen
delivery system for mucosal immunization, we decided to evaluate the
immune response of mice after intranasal or oral administration of
recombinant L. lactis producing BLG. We thought that
such tools would be helpful to study and perhaps modulate the specific
immunoglobulin E (IgE) response induced by BLG. BLG was previously
expressed in E. coli (4, 7, 8), but this gram-negative bacterium contains lipopolysaccharides which enhance the
inflammation process, and some strains are pathogenic for humans and animals.
We constructed strains of L. lactis producing recombinant
bovine BLG (rBLG). Both intra- and extracellular locations of rBLG were
assessed using the nisin-inducible expression system (9, 10). The highest production was obtained when the mature part of
BLG was fused to the signal peptide of the major L. lactis secreted protein Usp45 (34). The recombinant allergen was detected predominantly in a soluble, intracellular, and mostly denatured form in
the different constructs. BLG-specific fecal IgA Ab were detected in
mice 3 weeks after oral or intranasal administration of the lactococcal
BLG-secreting strain. BLG-specific IgE, IgA, IgG1, or IgG2a Ab were not
detected in sera of the same mice. Here, we demonstrated that
recombinant lactococci constitute good tools to induce a mucosal immune
response against BLG after intranasal or oral administration to mice.
Bacterial strains, plasmids, and growth conditions.
The
strains and plasmids used in this study are listed in Table
1. L. lactis strains were
grown at 30°C in M17 medium containing 0.5% glucose
(32). E. coli strains were grown in
Luria-Bertani medium at 37°C with vigorous shaking. When required,
antibiotics were added at the following concentrations, except when
otherwise stated: ampicillin, 50 µg/ml; chloramphenicol, 25 µg/ml
for E. coli and 10 µg/ml for L. lactis; and
erythromycin, 5 µg/ml.
1071-412X/01/$04.00+0 DOI: 10.1128/CDLI.8.3.545-551.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Induction of Mucosal Immune Response after Intranasal or Oral
Inoculation of Mice with Lactococcus lactis Producing
Bovine Beta-Lactoglobulin
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used in this study
General DNA techniques, PCR, and transformation. Plasmid DNA was isolated essentially as described previously (5). For L. lactis, cells were incubated in TES [N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid] buffer containing 10 mg of lysozyme per ml at 37°C for 10 min before alkaline lysis. Restriction enzymes and T4 DNA ligase (Gibco BRL or New England Biolabs) were used according to the instructions of the suppliers. PCR was performed with a Perkin-Elmer Cetus (Norwalk, Conn.) thermocycler. Electrotransformation of L. lactis was performed as described previously (21), and transformants were plated on M17-0.5% glucose agar plates containing the required antibiotic.
Construction of expression plasmids carrying the
blg gene. (i) Cloning of blg under the
control of a constitutive lactococcal promoter.
A 550-bp DNA
fragment encoding the entire mature BLG under the translational control
of an E. coli ribosome-binding site (RBS) was purified after
EcoRI digestion of plasmid pTTQ18
lac.7.7.1 (kindly
provided by C. Batt) (4). This blg gene was
then inserted downstream of the strong L. lactis
constitutive promoter P59 (36) by
cloning the fragment in an EcoRI-linearized plasmid, pVE3556
(22). The ligation mix was then used to transform L. lactis MG1363. The structure of the resulting plasmid, pIL:BLG (Fig. 1), was confirmed by restriction
enzyme digestion and DNA sequencing. pIL:BLG was then introduced into
L. lactis NZ9000 (kindly provided by Oscar Kuipers)
(20) to be comparable to other inducible constructions
(see description below).
|
(ii) Cloning of blg under the control of a
nisin-inducible promoter.
The blg gene was amplified
from pTTQ18
lac.7.7.1 (4) using primers BLGLacF
(GCCCAATGCATTGGTTCTGATCGTTACCCAGACC) and
BLGLacR (GCGCTCGAGGCGCTAGATGTGGCACTGCTC), adding
an NsiI site (italicized) at the N terminus of BLG and an
XhoI site (italicized) at the C terminus of BLG. This PCR
fragment encoded a BLG fragment starting at position
Leu17 of the complete protein. The amplified
sequence was inserted in SrfI-linearized pPCR-Script Amp SK
(+) plasmid as described by the supplier (Stratagene, La Jolla,
Calif.). The clone, named BLG-Lacto-pPCR-Script 4.1, was confirmed by
DNA sequencing (MWG Biotech, Ebersberg, Germany). The expression
plasmids pCYT:Nuc and pSEC:Nuc (P. Langella et al., unpublished
data), which allow cloning of the blg gene under the
control of the L. lactis inducible promoter
PnisA, are described in Table 1. Briefly,
pSEC:Nuc and pCYT:Nuc are derivatives of pNZ8010 (kindly provided by
Oscar Kuipers) (9, 10) (Table 1), in which the
gus gene was under the transcriptional control of the
promoter of nisA, PnisA. The
gus gene was first deleted by XhoI digestion and
replaced by a BamHI-XhoI-cut DNA fragment
encoding the RBS, the signal peptide of the usp45 gene
product (34) and the mature part of the staphylococcal
nuclease protein (22) to obtain the plasmid pSEC:Nuc. This
construct allowed us to direct expression of BLG in a secreted form. By
using reverse PCR, the DNA fragment encoding the signal peptide of
Usp45 was also deleted to obtain pCYT, thus allowing BLG expression in
the cytoplasm. An NsiI site was introduced at the 3' end of
the RBS of Usp45 to allow the replacement of part of the nuc
gene segment by a DNA fragment encoding a heterologous protein.
pCYT:BLG and pSEC:BLG were constructed by inserting the blg
gene in pCYT:Nuc and pSEC:Nuc expression vectors (Fig. 1), as follows.
In parallel, pCYT:Nuc, pSEC:Nuc, and BLG-Lacto-pPCR-Script 4.1 were
digested by NsiI and XhoI. Both double-digested
vectors and the insert containing the BLG sequence were purified, and the insert and vector were ligated and electroporated in E. coli strain DH5
(16). Clones containing the BLG
sequence were selected by PCR and digestion with restriction enzyme.
Plasmids were introduced by electroporation into L. lactis
strain NZ9000 containing on its chromosome nisR and
nisK, the two regulatory genes of
PnisA, which allows induction of the synthesis
of foreign proteins in a dose-dependent manner and the attainment of
high-level production. Plasmids isolated from the resulting strains,
NZ9000(pCYT:BLG) and NZ9000(pSEC:BLG), were confirmed by DNA sequencing.
Purification of BLG from cow's milk. Natural BLG was purified from the milk of a single cow homozygous for the variant A of BLG as described by Wal et al. (38) and here is considered to be BLG in the native conformation (BLGn). Reduced and carboxymethylated BLG (BLGrcm) was prepared from BLGn as described by Negroni et al. (25) by a method slightly modified from that of McKenzie et al. (24) and here is considered to be BLG in the denatured conformation (BLGd).
Two-site enzyme immunometric assay for BLGn and BLGd. Anti-BLG MAb production and characterization and development of the two-site enzyme immunometric assays for BLGn and BLGd were described by Negroni et al. (25). Briefly, assays were performed in 96-well microtiter plates (Maxisorp; Nunc, Roskilde, Denmark) coated with a first MAb (capture antibody) specific for either BLGn or BLGrcm (BLGd). Fifty microliters of standard (BLGn or BLGrcm) or sample and 50 µl of tracer, which consists of a second MAb labeled with acetylcholinesterase (AChE) (15), a conjugate recognizing either BLGn or BLGrcm, were then added. Capture and tracer Ab are directed against different complementary epitopes. After 18 h of reaction at 4°C, the plates were washed and solid-phase-bound AChE activity was measured using the method of Ellman et al. (12). Detection limits of 30 and 200 pg/ml were obtained for BLGn and BLGrcm, respectively, with very low or negligible cross-reactivity of the other milk proteins or tryptic fragments of BLG. Cross-reactivity of the BLGn assay with BLGrcm is 0.4%, and cross-reactivity of the BLGrcm assay with BLGn is 0.018%.
SDS-PAGE and immunoblot analysis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis was performed using a Tricine buffer as described by Schagger and von Jagow (30). For immunoblot analysis, proteins were separated by SDS-12% PAGE and electroblotted (33) onto a polyvinylidene difluoride membrane (Millipore, Bedford, Mass.). After blotting, nonspecific protein-binding sites were blocked with 1% bovine serum albumin in 50 mM Tris-HCl (pH 8)-150 mM NaCl-0.5% Tween 20. The nylon membranes were incubated overnight with a 1/100,000 dilution of MAb specific for BLGrcm (BLG-74R) (25). After washing, the membranes were incubated for 1 h with alkaline phosphatase-conjugated anti-mouse antibody (1/5,000) (Jackson ImmunoResearch Laboratories, West Grove, Pa.). Color development was obtained according to the supplier's instructions.
L. lactis protein extraction. Overnight cultures of strains NZ9000(pIL:BLG), NZ9000(pCYT:BLG), and NZ9000(pSEC:BLG) were used to inoculate fresh medium at a dilution of 1:250. For induction of the nisA promoter, strains were grown to an optical density at 600 nm of 0.5, and nisin (Sigma, St. Louis, Mo.) was added to a final concentration of 10 ng/ml. Growth was continued for 1 h. For strain NZ9000(pIL:BLG), growth was continued without addition of nisin until an optical density at 600 nm of 1.0 was reached. To prepare extracts, cells were pelleted by centrifugation at 5,000 × g for 15 min at 4°C and the supernatant (S) was collected. The soluble cytoplasmic protein (Cs) was extracted by disrupting cells with glass beads resuspended in 1/10 of the initial volume of 50 mM Tris-HCl, pH 7.4. Extracts were then centrifuged at 10,000 × g for 15 min at 4°C. The supernatant corresponding to Cs was collected, and the pellet was resuspended in 1/10 of the initial volume of 50 mM Tris-HCl (pH 7.4)-8 M urea-100 mM dithiothreitol for 1 h at room temperature. After centrifugation at 10,000 × g for 15 min at room temperature, the supernatant containing resolubilized insoluble cytoplasmic protein (Ci) was collected and then dialyzed against 50 mM Tris-HCl, pH 7.4. The amounts of BLGn and BLGd in the S, Cs, and Ci preparations were assayed using the two immunoassays described above.
Immunizations.
Recombinant strain NZ9000(pSEC:BLG) and
control strain NZ9000(pSEC:Nuc) were grown as described above and
induced for 1 h with nisin. Cells were pelleted, resuspended in
sterile phosphate-buffered saline (PBS) to obtain the same
concentration of cells for each strain, aliquoted, and frozen at
80°C. Yields of rBLGn and rBLGd in one aliquot were determined as
described above. Groups of four mice were immunized orally or
intranasally with the induced recombinant strain, the induced control
strain, and BLGrcm in PBS. Oral doses of 15 µg of BLGrcm, the
quantity of cells of NZ9000(pSEC:BLG) corresponding to 15 µg of
BLGrcm, and the same quantity of cells of NZ9000(pSEC:Nuc), in 150 µl
of suspension, were administered intragastrically on days 1, 2, and 3. Intranasal doses of 1.5 µg of BLGrcm, the quantity of cells from
NZ9000(pSEC:BLG) corresponding to 1.5 µg of BLGrcm, or the same
quantity of cells from the control strain were slowly administered to
mice in 15 µl of suspension on days 1, 2, and 3. Serum samples and
fecal pellets were taken on days 0 and 19.
ELISA for the detection of BLG-specific serum antibody. The enzyme-linked immunosorbent assay (ELISA) was previously described in detail by Adel-Patient et al. (1). Briefly, 96-well microtiter plates (Maxisorp; Nunc) coated with 5 µg of BLGrcm per ml were incubated overnight with serial dilutions of sera from immunized mice. After washing, IgE, IgG1, or IgG2a binding was revealed by incubation with a rat anti-mouse IgE MAb (clone LOME-3) from Serotec (Oxford, England) or a goat anti-mouse IgG1 or goat anti-mouse IgG2a polyclonal affinity-purified Ab (Southern Biotechnology Associates, Birmingham, Ala.) labeled with AChE (15). AChE activity was detected using the method of Ellman et al. (12) by reading absorbance at 414 nm. The minimum detectable concentrations are 8 pg/ml for IgE, 7 pg/ml for IgG1, and 12 pg/ml for IgG2a.
Measurement of fecal and serum IgA response. Fresh fecal pellets were collected at days 0 and 19 from groups of mice that had been immunized intranasally or orally. Fecal pellet (0.1 g) was added to 1 ml of PBS containing 1% bovine serum albumin, 50 µg of bacitracin per ml, 300 µg of benzamidine per ml, 80 µg of leupeptin per ml, 20 µg of chymostatin per ml, 25 µg of pepstatin per ml, and 200 µM phenylmethylsulfonyl fluoride (Sigma) and incubated on rotary shaker overnight at 4°C. The tubes were vortexed to disrupt all solid material and then centrifuged at 16,000 × g for 5 min at 4°C. The supernatant was removed and tested by ELISA for the presence of BLG-specific IgA as described above. IgA was detected using a goat polyclonal serum anti-mouse IgA (Southern Biotechnology Associates) labeled with AChE (15) and detected as described above. The same assay was used to evaluate specific IgA in serum.
| |
RESULTS |
|---|
|
|
|---|
Growth of L. lactis producing BLG depends on the
expression system.
To produce rBLG in L. lactis, the
cDNA of the blg gene was cloned in L. lactis
MG1363 or NZ9000 under the control of P59, a
strong L. lactis constitutive promoter (35), on
pIL, a high-copy-number plasmid, resulting in pIL:BLG (Fig. 1). To
achieve inducible expression of blg, the nisin-inducible
promoter PnisA was used to promote intracellular
BLG expression on plasmid pCYT:BLG (Fig. 1). To obtain a secreted form
of BLG, the blg gene fragment was also fused in frame with
the signal sequence of Usp45, the major L. lactis secreted
protein (33), and placed under the control of
PnisA, resulting in pSEC:BLG (Fig. 1).
These two plasmids were introduced into L. lactis, resulting in strains NZ9000(pCYT:BLG) and
NZ9000(pSEC:BLG). Growth of the three strains was monitored without nisin for NZ9000(pIL:BLG) and with or without nisin for the
inducible strains (Fig. 2). The growth of
strain NZ9000(pIL:BLG) was similar to the growth of the
inducible strains in the absence of nisin. Addition of nisin led to a
marked decrease in the growth of strains NZ9000(pCYT:BLG) and
NZ9000(pSEC:BLG), suggesting a disadvantage due to the induction of
the production of rBLG.
|
The fusion with a lactococcal signal peptide leads to the highest
rBLG production in L. lactis.
For the three
strains, rBLG was assayed using specific immunoassays for BLG in the
native (rBLGn) or denatured (rBLGd) conformation in the supernatant
fraction (S) and the soluble (Cs) and insoluble (Ci) cellular fractions
(Table 2). Total production of rBLG was calculated by adding the amounts of rBLGn and rBLGd in S, Cs, and Ci
for each strain. The values given in Table 2 represent the means and
standard deviations from five independent experiments. Total production
was 20.3 ± 3.2 ng/ml, 121 ± 28 ng/ml, and 1,906 ± 355 ng/ml of culture for strain NZ9000 containing pIL:BLG, pCYT:BLG, and
pSEC:BLG, respectively (Table 2).
|
The precursor preUsp:rBLG is weakly processed.
Production of
rBLG was induced in strains NZ9000(pCYT:BLG) and
NZ9000(pSEC:BLG) as described above. The BLG protein content of
total cell extracts was analyzed by Western blot experiments using MAb
specific for BLGd. rBLG produced by NZ9000(pCYT:BLG) migrated at
the same distance as the native BLG (not shown), corresponding to
around 18,000 Da, whereas a larger band was detected in
NZ9000(pSEC:BLG) (Fig. 3). The size
of this protein form corresponds to around 21,000 Da, which is the size
expected for the intracellular precursor form preUsp:rBLG containing
the signal peptide of Usp45, suggesting a very weak cleavage of the
preUsp:rBLG. The same profile was obtained with different MAb
recognizing different linear epitopes of BLG. A degradation band was
never observed.
|
Mucosal antibody response.
Groups of four mice were inoculated
intranasally or orally with recombinant strain NZ9000(pSEC:BLG),
strain NZ9000(pSEC:Nuc) as a control strain, or purified denatured
BLG. Three weeks after immunization, fresh fecal pellets from mice
immunized intranasally or orally with NZ9000(pSEC:BLG) elicited a
high BLG-specific mucosal IgA response (Fig.
4). The specific response intensity
obtained with strain NZ9000(pSEC:BLG) was higher after oral than
after intranasal administration (P < 0.05 [t test]). In contrast, sera from immunized mice did not
contain significant levels of BLG-specific IgA, IgG1, IgG2a, or IgE
(data not shown). This suggests that the IgA response is located
only at the mucosal level. Intranasal or oral administration of
BLGrcm elicited a very low BLG-specific IgA level equivalent to that of
naive mice, which represents nonspecific background. Though slightly
higher, the response obtained with the control strain was of the same
order as that in naive mice, although it was higher after intranasal
administration than after oral administration (P > 0.05 [t test]).
|
| |
DISCUSSION |
|---|
|
|
|---|
In this paper, we describe for the first time the induction of a mucosal BLG-specific immune response in mice immunized with recombinant L. lactis BLG producer strains. We determined the type and the localization of immune response elicited in mice after administration of L. lactis producing BLG. Our long-term goal is to study and perhaps modulate immune responses to food allergens with BLG as the protein model and recombinant L. lactis strains as the delivery vehicle.
For this purpose, three rBLG-producing L. lactis strains were constructed to produce rBLG in cytoplasmic and extracellular locations under the control of a constitutive or an inducible promoter. The rates of growth of the three stains were very different and correlated with rBLG production. The lowest and highest rBLG production was obtained with L. lactis strains NZ9000(pIL:BLG) and NZ9000(pSEC:BLG), respectively. In strain NZ9000(pIL:BLG), rBLG was detected intracellularly at a very low level in spite of the use of a high-copy-number cloning vector and of P59, a strong lactococcal constitutive promoter. This low production is probably due to the use of an E. coli RBS that did not allow efficient translation in L. lactis. To increase the production of rBLG, the E. coli RBS was replaced by the RBS of the L. lactis secreted protein Usp45 and the blg gene was placed under the transcriptional control of the nisin-inducible promoter PnisA. In strain NZ9000(pSEC:BLG), the blg gene was fused to the signal peptide of Usp45. These modifications led to a dramatic enhancement of the production of rBLG compared to the constitutive production: 16- and 95-fold compared to inducible and constitutive intracellular production, respectively. Our hypothesis to explain this enhancement is that the precursor preUsp:rBLG could be more efficiently translated in NZ9000(pSEC:BLG) than the intracellular forms of rBLG produced in NZ9000(pIL:BLG) or NZ9000(pCYT:BLG). These forms remain inside the cells as aggregates close to the translation machinery and would congest it. Furthermore, the recognition of preUsp:rBLG by the machinery of secretion of L. lactis could allow it to escape intracellular proteolysis even if no degradation band was observed. The same observations have also been recently made in the case of production in L. lactis of the nonstructural protein NSP4 of bovine rotavirus (13) and of the Brucella abortus ribosomal protein L7/L12 (L. Ribeiro et al., unpublished data).
rBLG is produced in the three strains mostly in the denatured form. This observation could be due to the absence of a homologue of DsbA (3), the protein able to build disulfide bonds in L. lactis (6). It is secreted in very small quantities, i.e., 3% of the total rBLG produced in NZ9000(pSEC:BLG), as in E. coli. In Western blot experiments, we showed that rBLG present in cellular fractions of strain NZ9000(pSEC:BLG) has a molecular weight higher than that in NZ9000(pCYT:BLG). This result indicates that the majority of rBLG is present as the unprocessed intracellular precursor preUsp:rBLG. In E. coli, rBLG is not secreted but is totally processed (7). rBLG found in the supernatant does not result from bacterial lysis, because the proportion of BLGn to BLGd is higher in the supernatant than in the cytoplasm and because no rBLG can be detected in the supernatant of NZ9000(pIL:BLG) or NZ9000(pCYT:BLG). This low maturation of preUsp:rBLG could be due to a low recognition of this hybrid precursor by the machinery of secretion of L. lactis, which leads to the formation of aggregates. At this point, we can note that until now (i) only Usp45, a protein of unknown function, seems to be constitutively secreted efficiently by L. lactis (34), and (ii) only bacterial heterologous proteins have been efficiently secreted in L. lactis (23). Using the staphylococcal nuclease as the secreted model protein, Le Loir et al. (23) showed that a positive net global charge in the first 10 amino acid residues of the N-terminal part of the nuclease resulted in a dramatic decrease in its secretion efficiency in L. lactis. Analysis of the first 10 amino acid residues of the N-terminal part of rBLG revealed the presence of an Arg residue at position +10, resulting in a net global charge of +1. Experiments are currently in progress to investigate the effect of mutation of BLG at this Arg residue and of the insertion of a synthetic propeptide (23) on the secretion efficiency of rBLG.
Few eukaryotic proteins have been produced in L. lactis, with different results. Hen egg white lysozyme could be detected in L. lactis lysates by Western blotting experiments, but no lysozyme activity was observed (35). In contrast, biologically active murine interleukin-2 (IL-2) and IL-6 were secreted by L. lactis (900 ng/ml) (31). A biologically active bovine plasmin was also produced (1,000 ng/ml) and weakly secreted in L. lactis (2).
Expression of BLG in the model gram-negative bacterium E. coli has been previously described (4, 7, 8). One difference between E. coli and L. lactis is in the quantity of rBLG produced. NZ9000(pSEC:BLG) produced around 2 mg/liter of culture medium, 10- to 100-fold less than E. coli (4, 7, 8). Another difference is the proportion of soluble rBLG. In E. coli, soluble rBLG reached 30% at most (7), whereas in L. lactis it was never less than 80%. As in E. coli, the amount of rBLG in the native conformation in L. lactis seems to be correlated with global production of rBLG (7).
After intranasal inoculation of a recombinant inducible strain expressing TTFC, an antigen-specific Ig serum response has been observed, but no antigen-specific fecal IgA was detected (26). Using a constitutive strain expressing TTFC and another immunization protocol, Robinson et al. obtained an antigen-specific Ig serum response and antigen-specific IgA Ab in feces after oral or intranasal administration (28). Immunized mice were protected against further challenge with tetanus toxin in both experiments. Since the biochemical characteristics of rBLG produced in the three strains were the same, we used recombinant strain NZ9000(pSEC:BLG) to immunize mice via the oral or intranasal route because it was the most productive strain. Both types of administration elicited a high BLG-specific enteric response, but no antigen-specific serum Ig response was detected. In our immunization experiment, we administered the same quantity of BLG alone or of BLG expressed by the recombinant strain, e.g.,15 or 1.5 µg. In the two types of administration, the responses elicited by the recombinant strain were on the same order as in naive mice, which represents nonspecific background. Administration of BLG via L. lactis seems to increase the bioavailability of BLG and/or to act as an adjuvant. This result was also found in the case of TTFC (28).
Intranasal or oral administration of the control strain elicited a response that is also on the order of that in naive mice. Nevertheless, the response obtained with the control strain after intranasal administration was greater than that after oral administration. This could be due to cross-reactivity with a protein of L. lactis and BLG, but no significant sequence homology was found between BLG and the L. lactis genome, so the explanation is probably nonspecific background reactivity. Robinson et al. also noted high nonspecific binding in their TTFC-specific fecal IgA responses (28). The intensities of response obtained with their control strain represented between 20 and 60% of that measured with the recombinant strain expressing TTFC.
In our experiments, we used L. lactis that was killed by freezing. This allowed us to quantify the production of rBLG and to control exactly the quantity of rBLG administered to mice. In any case, L. lactis administered by feeding, as in our experiments, died very rapidly and lysed, whereas L. lactis that transits with food survives longer (11). Nevertheless, immunization of mice with live bacteria is under investigation. It seems that in the L. lactis feeding experiment, secretion was not necessary because BLG is released in the digestive tract by lysis. In the case of TTFC, the recombinant protein is also intracellularly accumulated (40). Nevertheless, secretion is not a handicap, because it was demonstrated that immunization of mice with a recombinant strain coexpressing intracellular TTFC and secreting IL-2 or IL-6 increased the anti-TTFC antibody titer (31).
Our results show that addition of the signal peptide of Usp45 to obtain secretion allows a significant increase of expression even if the efficacy of secretion is low. Moreover, we demonstrate that recombinant L. lactis is a good vector to elicit local immune responses even to eukaryotic proteins. Evaluation of the effects of this recombinant strain in a high-IgE-responder mouse model of allergy to BLG is under way.
| |
ACKNOWLEDGMENTS |
|---|
We thank Oscar P. Kuipers for L. lactis strain NZ9000 and for plasmid pNZ8010. We are grateful to Alexandra Gruss, Yves Le Loir, and Sébastien Nouaille for helpful discussions during the course of this work.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Unité de Recherches Laitières et de Génétique Appliquée, INRA, 78352 Jouy en Josas, France. Phone: 33(0)1 34 65 20 83. Fax: 33(0)1 34 65 20 65. E-mail: langella{at}biotec.jouy.inra.fr.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Adel-Patient, K., C. Creminon, H. Bernard, G. Clement, L. Negroni, Y. Frobert, J. Grassi, J. Wal, and J. M. Chatel. 2000. Evaluation of a high IgE-responder mouse model of allergy to bovine beta-lactoglobulin (BLG): development of sandwich immunoassays for total and allergen-specific IgE, IgG1 and IgG2a in BLG-sensitized mice. J. Immunol. Methods 235:21-32[CrossRef][Medline]. |
| 2. | Arnau, J., E. Hjerl-Hansen, and H. Israelsen. 1997. Heterologous gene expression of bovine plasmin in Lactococcus lactis. Appl. Microbiol. Biotechnol. 48:331-338[CrossRef][Medline]. |
| 3. | Bardwell, J. C. 1994. Building bridges: disulphide bond formation in the cell. Mol. Microbiol. 14:199-205[CrossRef][Medline]. |
| 4. | Batt, C. A., L. D. Rabson, D. W. Wong, and J. E. Kinsella. 1990. Expression of recombinant bovine beta-lactoglobulin in Escherichia coli. Agric. Biol. Chem. 54:949-955[Medline]. |
| 5. |
Birnboim, H. C., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523 |
| 6. | Bolotine, A., S. Mauger, K. Malarmé, S. D. Ehrlich, and A. Sorokin. 1999. Low redundancy sequencing of entire Lactococcus lactis IL 1403 genome. Antonie Leeuwenhoek 76:27-76[CrossRef][Medline]. |
| 7. | Chatel, J. M., K. Adel-Patient, C. Creminon, and J. M. Wal. 1999. Expression of a lipocalin in prokaryote and eukaryote cells: quantification and structural characterization of recombinant bovine beta-lactoglobulin. Protein Expr. Purif. 16:70-75[CrossRef][Medline]. |
| 8. | Chatel, J. M., H. Bernard, G. Clement, Y. Frobert, C. A. Batt, J. Gavalchin, G. Peltres, and J. M. Wal. 1996. Expression, purification and immunochemical characterization of recombinant bovine beta-lactoglobulin, a major cow milk allergen. Mol. Immunol. 33:1113-1118[CrossRef][Medline]. |
| 9. |
de Ruyter, P. G.,
O. P. Kuipers,
M. M. Beerthuyzen,
I. Alen-Boerrigter, and W. M. de Vos.
1996.
Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis.
J. Bacteriol.
178:3434-3439 |
| 10. | de Ruyter, P. G., O. P. Kuipers, and W. M. de Vos. 1996. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl. Environ. Microbiol. 62:3662-3667[Abstract]. |
| 11. |
Drouault, S.,
G. Corthier,
S. D. Ehrlich, and P. Renault.
1999.
Survival, physiology, and lysis of Lactococcus lactis in the digestive tract.
Appl. Environ. Microbiol.
65:4881-4886 |
| 12. | Ellman, G. L., K. D. Courtney, V. Andres, and R. M. Featherstone. 1961. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7:88-95[CrossRef][Medline]. |
| 13. |
Enouf, V.,
P. Langella,
J. Commissaire,
J. Cohen, and G. Corthier.
2001.
Bovine rotavirus nonstructural protein 4 produced by Lactococcus lactis is antigenic and immunogenic.
Appl. Environ. Microbiol.
67:1423-1428 |
| 14. | Fargeas, J. M., V. Theodorou, J. More, J. M. Wal, J. Fioramonti, and L. Bueno. 1995. Boosted systemic immune and local responsiveness after intestinal inflammation in orally sensitized guinea pigs. Gastroenterology 109:53-62[CrossRef][Medline]. |
| 14a. |
Gasson, M. J.
1983.
Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing.
J. Bacteriol.
154:1-9 |
| 15. | Grassi, J., Y. Frobert, P. Pradelles, F. Chercuitte, D. Gruaz, J. M. Dayer, and P. E. Poubelle. 1989. Production of monoclonal antibodies against interleukin-1 alpha and -1 beta. Development of two enzyme immunometric assays (EIA) using acetylcholinesterase and their application to biological media. J. Immunol. Methods 123:193-210[CrossRef][Medline]. |
| 16. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 17. | Host, A., and S. Halken. 1998. Epidemiology and prevention of cow's milk allergy. Allergy 53:111-113[Medline]. |
| 18. | Host, A., H. P. Jacobsen, S. Halken, and D. Holmenlund. 1995. The natural history of cow's milk protein allergy/intolerance. Eur. J. Clin. Nutr. 49(Suppl. 1):S13-S18. |
| 19. | Isolauri, E., H. Majamaa, T. Arvola, I. Rantala, E. Virtanen, and H. Arvilommi. 1993. Lactobacillus casei strain GG reverses increased intestinal permeability induced by cow milk in suckling rats. Gastroenterology 105:1643-1650[Medline]. |
| 20. | Kuipers, O. P., P. G. de Ruyter, M. Kleerebezen, and W. M. de Vos. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. J. Biotechnol. 64:15-21. |
| 21. |
Langella, P.,
Y. Le Loir,
S. D. Ehrlich, and A. Gruss.
1993.
Efficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis.
J. Bacteriol.
175:5806-5813 |
| 22. |
Le Loir, Y.,
A. Gruss,
S. D. Ehrlich, and P. Langella.
1994.
Direct screening of recombinants in gram-positive bacteria using the secreted staphylococcal nuclease as a reporter.
J. Bacteriol.
176:5135-5139 |
| 23. |
Le Loir, Y.,
A. Gruss,
S. D. Ehrlich, and P. Langella.
1998.
A nine-residue synthetic propeptide enhances secretion efficiency of heterologous proteins in Lactococcus lactis.
J. Bacteriol.
180:1895-1903 |
| 24. |
McKenzie, H. A.,
G. B. Ralston, and D. C. Shaw.
1972.
Location of sulfhydryl and disulfide groups in bovine -lactoglobulins and effects of urea.
Biochemistry
11:4539-4547[CrossRef][Medline].
|
| 25. | Negroni, L., H. Bernard, G. Clement, J. M. Chatel, P. Brune, Y. Frobert, J. M. Wal, and J. Grassi. 1998. Two-site enzyme immunometric assays for determination of native and denatured beta-lactoglobulin. J. Immunol. Methods 220:25-37[CrossRef][Medline]. |
| 26. | Norton, P. M., J. M. Wells, H. W. Brown, A. M. Macpherson, and R. W. Le Page. 1997. Protection against tetanus toxin in mice nasally immunized with recombinant Lactococcus lactis expressing tetanus toxin fragment C. Vaccine 15:616-619[CrossRef][Medline]. |
| 27. | Papiz, M. Z., L. Sawyer, E. E. Eliopoulos, A. C. North, J. B. Findlay, R. Sivaprasadarao, T. A. Jones, M. E. Newcomer, and P. J. Kraulis. 1986. The structure of beta-lactoglobulin and its similarity to plasma retinol-binding protein. Nature 324:383-385[CrossRef][Medline]. |
| 28. | Robinson, K., L. M. Chamberlain, K. M. Schofield, J. M. Wells, and R. W. Le Page. 1997. Oral vaccination of mice against tetanus with recombinant Lactococcus lactis. Nat. Biotechnol. 15:653-657[CrossRef][Medline]. |
| 29. | Sanderson, I. R., and W. A. Walker. 1993. Uptake and transport of macromolecules by the intestine: possible role in clinical disorders (an update). Gastroenterology 104:622-639[Medline]. |
| 30. | Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379[CrossRef][Medline]. |
| 31. |
Steidler, L.,
K. Robinson,
L. Chamberlain,
K. M. Schofield,
E. Remaut,
R. W. Le Page, and J. M. Wells.
1998.
Mucosal delivery of murine interleukin-2 (IL-2) and IL-6 by recombinant strains of Lactococcus lactis coexpressing antigen and cytokine.
Infect. Immun.
66:3183-3189 |
| 32. | Terzaghi, B., and W. E. Sandine. 1975. Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29:807-813. |
| 33. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 34. | van Asseldonk, M., G. Rutten, M. Oteman, R. J. Siezen, W. M. de Vos, and G. Simons. 1990. Cloning of usp45, a gene encoding a secreted protein from Lactococcus lactis subsp. lactis MG1363. Gene 95:155-160[CrossRef][Medline]. |
| 35. | van de Guchte, M., F. J. van der Wal, J. Kok, and G. Venema. 1992. Lysozyme expression in Lactococcus lactis. Appl. Microbiol. Biotechnol. 37:216-224[Medline]. |
| 36. |
van der Vossen, J. M.,
D. van der Lelie, and G. Venema.
1987.
Isolation and characterization of Streptococcus cremoris Wg2-specific promoters.
Appl. Environ. Microbiol.
53:2452-2457 |
| 37. | Wal, J. M. 1998. Cow's milk allergen. Allergy 53:1013-1022[Medline]. |
| 38. | Wal, J. M., H. Bernard, C. Creminon, C. Hamberger, B. David, and G. Peltre. 1995. Cow's milk allergy: the humoral immune response to eight purified allergens. Adv. Exp. Med. Biol. 371B:879-881. |
| 39. | Wells, J. M., K. Robinson, L. M. Chamberlain, K. M. Schofield, and R. W. Le Page. 1996. Lactic acid bacteria as vaccine delivery vehicles. Antonie Leeuwenhoek. 70:317-330. |
| 40. | Wells, J. M., P. W. Wilson, P. M. Norton, M. J. Gasson, and R. W. Le Page. 1993. Lactococcus lactis: high-level expression of tetanus toxin fragment C and protection against lethal challenge. Mol. Microbiol. 8:1155-1162[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»