This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bekker, C. P. J.
Right arrow Articles by Jongejan, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bekker, C. P. J.
Right arrow Articles by Jongejan, F.

 Previous Article  |  Next Article 

Clinical and Diagnostic Laboratory Immunology, July 2001, p. 843-846, Vol. 8, No. 4
1071-412X/01/$04.00+0   DOI: 10.1128/CDLI.8.4.843-846.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Heartwater (Cowdria ruminantium Infection) as a Cause of Postrestocking Mortality of Goats in Mozambique

Cornelis P. J. Bekker,1 Daan Vink,2 Carlos M. Lopes Pereira,3,dagger Wendela Wapenaar,2 Afonso Langa,3 and Frans Jongejan2,4,*

Division of Bacteriology1 and Division of Parasitology and Tropical Veterinary Medicine,2 Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands; Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Onderstepoort 0110, South Africa4; and Faculdade de Veterinária, Universidade de Eduardo Mondlane, Maputo, Mozambique3

Received 9 November 2000/Returned for modification 17 January 2001/Accepted 4 April 2001


    ABSTRACT
Top
Abstract
Text
References

A serological survey in Mozambique to detect antibodies to Cowdria ruminantium, the etiologic agent of heartwater, revealed a seroprevalence of 8.1% (n = 332) for goats in the northern province of Tete and of 65.6% (n = 326) for goats in the southern provinces. Translocation of 10 serologically negative goats from Tete to farms in the south resulted in two clinical cases of heartwater that were fatal. In addition, four goats seroconverted within the study period of 5 weeks. One goat showed no symptoms. Two goats died of other causes, whereas the remaining goat went missing after 1 week. Experimental needle infections of goats and sheep were conducted to confirm results and to isolate different strains of C. ruminantium. These data indicate that translocation of goats from the north to the south of Mozambique bears a high risk of C. ruminantium infection, which can cause fatal disease.


    TEXT
Top
Abstract
Text
References

Heartwater (or cowdriosis) is a tick-borne disease affecting domestic ruminants throughout sub-Saharan Africa (10). The disease is caused by Cowdria ruminantium, a rickettsial agent transmitted by ticks of the genus Amblyomma, and constitutes a major constraint to livestock development in the affected areas (11). In Mozambique heartwater has been reported to occur throughout the country and mainly during the rainy season (3, 14). Following restocking of animals from the north to the south of the country, the incidence of disease and animal mortality have been extremely high: an estimated 50% of animals died within 1 year after translocation (7). It is suspected that tick-borne diseases, especially heartwater, contribute to this devastating outcome (7).

To investigate if C. ruminantium plays a role in the mortality after translocation, we conducted a serological survey in goats to estimate the prevalence of C. ruminantium exposure and a small-scale translocation experiment. Collected blood samples derived from different geographical areas were tested for the presence of C. ruminantium antibodies with the MAP1-B enzyme-linked immunosorbent assay (ELISA) (8, 13). The ELISA revealed a seroprevalence of 8.1% for animals kept in the northern part and a high seroprevalence of 65.6% in the southern part of Mozambique (Table 1). These data, which are consistent with a smaller immunofluorescence-based survey (3), suggest a considerable difference in exposure to C. ruminantium between animals kept in different parts of the country. The presence of antibodies is likely a good parameter of infection, as small ruminants remain seropositive for several years once they survive a C. ruminantium infection. The high seroprevalence in the south indicates that animals which are introduced in this area are at high risk of becoming infected with C. ruminantium.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   MAP1-B ELISA results for serum samples collected from goats in Mozambique

To ascertain that the observed apparent difference in exposure was caused by contact with the agent, 10 serologically negative goats (indigenous Landim breed) were translocated from Tete province to the Veterinary Faculty in Maputo in southern Mozambique. After a 10-day quarantine period at the Veterinary Faculty in Maputo, the goats were subdivided into two sentinel herds and placed at two farms south of Maputo (Porto Henrique and Bom Pastor) and were herded together with the local free-ranging goats. The goats were not treated with any acaricides during the trial. Blood samples were collected on a weekly basis for serological monitoring and at the occurrence of a persistent fever (rectal body temperature above 41.0°C) or nervous symptoms. Of the five animals that were translocated to Porto Henrique (Fig. 1), one goat died 10 days after arrival with severe nervous symptoms. Examination of Giemsa-stained brain crushed smears from this animal for the presence of rickettsial inclusion bodies in endothelial cells confirmed the presence of C. ruminantium. MAP-1B ELISA of collected blood samples indicated that three clinically healthy goats at Porto Henrique seroconverted within 35 days. The fifth goat remained seronegative for the entire duration of the study (5 weeks) (Table 2). At the second farm at Bom Pastor (Fig. 1), one goat died 22 days after field exposure with clinical symptoms of heartwater, but this diagnosis could not be confirmed as necropsy could not be performed. A second goat seroconverted without obvious clinical symptoms. Of the remaining three goats one went missing after 1 week and the other two died of other causes (Table 2).


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 1.   Map of Mozambique showing the locations where the research was conducted. Arrow, translocation of sentinel goats. Inset, enlargement of Maputo province.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Outcome of experimental translocation of goats from Tete to Maputo province

In order to definitively confirm that C. ruminantium was the etiologic agent of the diseased animals and to determine if different isolates were present, DNA was extracted from the blood samples of translocated goats showing clinical signs as well as from animals with cases of heartwater encountered in the south during the field study using the method described by Moreira (9). Part of the 16S rRNA gene (rDNA) was amplified using primer 16SF1 (gggctgcagAGTTTGATCCTGGCTCAG) (15) and primer 16SR8 (GGTTCACCTACAGCTACCTT) and was sequenced using primer 16SF1 on a ABI PRISM 310 sequencer. The entire 16S sequences of three samples were determined elsewhere (Baseclear, Leiden, The Netherlands). Blastn searches (National Center for Biotechnology Information website http://ncbi.nlm.nih.gov) using the obtained sequences revealed that samples from Porto Henrique (goat 1) and Bela Vista (field case of heartwater) were homologous to the C. ruminantium Crystal Springs isolate (4) (Table 3). The sequence of a sample from Bom Pastor (goat 6) was homologous to Ehrlichia sp. strain Omatjenne (1). The sequence of a second sample from Bela Vista was homologous, but not identical, to Anaplasma marginale (Table 4). Since this sample originated from a goat, we believe that it might be Anaplasma ovis, which has been reported to occur in sheep and goats in Mozambique (2). These data show that C. ruminantium and other Ehrlichia sp. were present simultaneously in goats, but it is not clear whether the goats were already infected with the Ehrlichia and Anaplasma species prior to translocation as they were only examined for antibodies against C. ruminantium.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Nucleotide differences between C. ruminantium isolates from a field case and from translocated goats in Mozambique and those present in GenBank in a fragment of 1,448 nucleotides of the 16S rDNA sequencea


                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Nucleotide differences between an Anaplasma sp. isolate from a goat in Bela Vista and the A. marginale 16S rDNA sequence present in GenBanka

Blood samples from suspected heartwater cases encountered in the south (Bela Vista) during the field study were used for experimental infection of Landim goats in Maputo to confirm the presence of C. ruminantium. Three goats died shortly after infection, and heartwater could be confirmed. A fourth goat seroconverted after a second inoculation since it was treated with antibiotics 2 days after the first inoculation. In The Netherlands three seronegative Texelaar sheep were subinoculated with 4 ml of blood (no. 172 blood from goat 1 at Porto Henrique, no. 173 blood from a field case at Bela Vista, and no. 174 blood from goat 6 at Bom Pastor) to confirm earlier findings and to start in vitro cultures. All three sheep developed fever and were treated with oxytetracyclines. They recovered, and seroconversion was demonstrated by the MAP1-B ELISA (Fig. 2). Despite the fact that sheep 174 seroconverted after treatment, no C. ruminantium 16S sequence homology was found for the sample used to infect this animal. To further investigate if C. ruminantium was present in this blood sample, a fourth sheep was infected (sheep 179). After the animal had succumbed, DNA was extracted from the brain of this animal; rickettsial inclusions were detected in the capillary endothelial cells. A hydropericardium was also detected in this animal, clearly indicating a fatal heartwater case. The 16S sequence obtained from this DNA was identical to the previously obtained sequence of the C. ruminantium Porto Henrique isolate (Table 3), which suggests that the original blood sample collected from goat 6 contained two bacterial species. To confirm this, the 16S PCR product obtained from the DNA extracted from the original sample was cloned and transformed to Escherichia coli. Ten clones were sequenced; 4 were homologous to C. ruminantium, and 6 were homologous to Ehrlichia sp. strain Omatjenne. Whether the presence of Ehrlichia played a role in the outcome of the disease remains to be investigated.


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2.   Rectal body temperature (solid lines) and MAP1-B ELISA results (dashed lines; PP, percentage positive) for four experimentally infected sheep. black-diamond , sheep 172 (Porto Henrique); black-triangle, sheep 173 (Bela Vista); , sheep 174 (Bom Pastor); open circle , sheep 179 (Bom Pastor). All reacting animals, except sheep 179, were treated with oxytetracycline at the second day of fever.

These data demonstrate that there is a risk of transmission of C. ruminantium to translocated goats if precautions are not taken and that transmission of C. ruminantium may cause fatal disease. Vaccination prior to translocation and proper tick control might be essential components of a successful restocking program in Mozambique.

Nucleotide sequence accession numbers. The entire 16S sequences of three samples were deposited in GenBank under accession no. AF318021 (C. ruminantium Porto Henrique), AF318022 (C. ruminantium Bela Vista), and AF318023 (Ehrlichia sp. Bom Pastor).


    ACKNOWLEDGMENTS

C. P. J. Bekker and D. Vink contributed equally to the work.

Luis Neves and Jos van Putten are thanked for critical reading of the manuscript and helpful comments.

This research was supported by the INCO-DC program of the European Union under contract no. IC18-CT95-0008. The Nuffic program UEM/UU/Animal health III of HHIMAP/MHO provided additional support. The work reported here was facilitated through the ICTTD Concerted Action Project, supported by the INCO-DC program of the EU under contract no. IC18-CT95-0009.


    FOOTNOTES

* Corresponding author. Mailing address: Division of Parasitology and Tropical Veterinary Medicine, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.165, 3508 TD Utrecht, The Netherlands. Phone: (31-30) 2532568. Fax: (31-30) 2540784. E-mail: F.Jongejan{at}vet.uu.nl.

dagger Present address: Veterinary Epidemiology Unit, National Directorate of Livestock, Ministry of Agriculture, Maputo, Mozambique.


    REFERENCES
Top
Abstract
Text
References

1. Allsopp, M., E. S. Visser, J. L. du Plessis, S. W. Vogel, and B. A. Allsopp. 1997. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences. Vet. Parasitol. 71:283-300[CrossRef][Medline].
2. Arnold, R. M., and J. A. Travassos Santos Dias. 1983. Ticks and tickborne haemoparasites of sheep and goats: seasonal distribution in Mozambique. World Anim. Rev. 45:28-35.
3. Asselbergs, M., F. Jongejan, A. Langa, L. Neves, and S. Afonso. 1993. Antibodies to Cowdria ruminantium in Mozambican goats and cattle detected by immunofluorescence using endothelial cell culture antigen. Trop. Anim. Health Prod. 25:144-150[CrossRef][Medline].
4. Dame, J. B., S. M. Mahan, and C. A. Yowell. 1992. Phylogenetic relationship of Cowdria ruminantium, agent of heartwater, to Anaplasma marginale and other members of the order Rickettsiales determined on the basis of 16S rRNA sequence. Int. J. Syst. Bacteriol. 42:270-274[Abstract/Free Full Text].
5. Du Plessis, J. L., L. van Gas, J. A. Olivier, and J. D. Bezuidenhout. 1989. The heterogenicity of Cowdria ruminantium stocks: cross-immunity and serology in sheep and pathogenicity to mice. Onderstepoort J. Vet. Res. 56:195-201[Medline].
6. Haig, D. A. 1952. Note on the use of the white mouse for the transport of strains of heartwater. J. S. Afr. Vet. Med. Assoc. 23:167-170.
7. Hanks, J., and C. M. Lopes Pereira. 1998. The development of a restocking decision support aid for Mozambique. Technical consultation RLA AGDX/AGA 11. Department of Agriculture, Reading, United Kingdom.
8. Mboloi, M. M., C. P. J. Bekker, C. Kruitwagen, M. Greiner, and F. Jongejan. 1999. Validation of the indirect MAP1-B enzyme-linked immunosorbent assay for diagnosis of experimental Cowdria ruminantium infection in small ruminants. Clin. Diagn. Lab. Immunol. 6:66-72[Abstract/Free Full Text].
9. Moreira, D. 1998. Efficient removal of PCR inhibitors using agarose-embedded DNA preparations. Nucleic Acids Res. 26:3309-3310[Abstract/Free Full Text].
10. Uilenberg, G. 1983. Heartwater (Cowdria ruminantium infection): current status. Adv. Vet. Sci. Comp. Med. 27:427-480[Medline].
11. Uilenberg, G., and E. Camus. 1993. Heartwater (cowdriosis), p. 293-332. In Z. Woldehiwet, and M. Ristic (ed.), Rickettsial and chlamydial diseases of domestic animals. Pergamon Press, Oxford, United Kingdom.
12. van Vliet, A. H., F. Jongejan, and B. A. van der Zeijst. 1992. Phylogenetic position of Cowdria ruminantium (Rickettsiales) determined by analysis of amplified 16S ribosomal DNA sequences. Int. J. Syst. Bacteriol. 42:494-498[Abstract/Free Full Text].
13. van Vliet, A. H. M., B. A. M. van der Zeijst, E. Camus, S. M. Mahan, D. Martinez, and F. Jongejan. 1995. Use of a specific immunogenic region on the Cowdria ruminantium MAP1 protein in a serological assay. J. Clin. Microbiol. 33:2405-2410[Abstract/Free Full Text].
14. Walker, J. B., and A. Olwage. 1987. The tick vectors of Cowdria ruminantium (Ixodoidea, Ixodidae, genus Amblyomma) and their distribution. Onderstepoort J. Vet. Res. 54:353-379[Medline].
15. Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697-703[Abstract/Free Full Text].
16. Yunker, C. E., B. Byrom, and S. Semu. 1988. Cultivation of Cowdria ruminantium in bovine vascular endothelial cells. Kenya Vet. 12:12-16.


Clinical and Diagnostic Laboratory Immunology, July 2001, p. 843-846, Vol. 8, No. 4
1071-412X/01/$04.00+0   DOI: 10.1128/CDLI.8.4.843-846.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Inokuma, H., Oyamada, M., Kelly, P. J., Jacobson, L. A., Fournier, P.-E., Itamoto, K., Okuda, M., Brouqui, P. (2005). Molecular Detection of a New Anaplasma Species Closely Related to Anaplasma phagocytophilum in Canine Blood from South Africa. J. Clin. Microbiol. 43: 2934-2937 [Abstract] [Full Text]  
  • Faburay, B., Munstermann, S., Geysen, D., Bell-Sakyi, L., Ceesay, A., Bodaan, C., Jongejan, F. (2005). Point Seroprevalence Survey of Ehrlichia ruminantium Infection in Small Ruminants in The Gambia. CVI 12: 508-512 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bekker, C. P. J.
Right arrow Articles by Jongejan, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bekker, C. P. J.
Right arrow Articles by Jongejan, F.