TEXT

Top Abstract Text References

Heartwater (or cowdriosis) is a tick-borne disease affecting domestic ruminants throughout sub-Saharan Africa (10). The disease is caused by Cowdria ruminantium, a rickettsial agent transmitted by ticks of the genus Amblyomma, and constitutes a major constraint to livestock development in the affected areas (11). In Mozambique heartwater has been reported to occur throughout the country and mainly during the rainy season (3, 14). Following restocking of animals from the north to the south of the country, the incidence of disease and animal mortality have been extremely high: an estimated 50% of animals died within 1 year after translocation (7). It is suspected that tick-borne diseases, especially heartwater, contribute to this devastating outcome (7).

To investigate if C. ruminantium plays a role in the mortality after translocation, we conducted a serological survey in goats to estimate the prevalence of C. ruminantium exposure and a small-scale translocation experiment. Collected blood samples derived from different geographical areas were tested for the presence of C. ruminantium antibodies with the MAP1-B enzyme-linked immunosorbent assay (ELISA) (8, 13). The ELISA revealed a seroprevalence of 8.1% for animals kept in the northern part and a high seroprevalence of 65.6% in the southern part of Mozambique (Table 1). These data, which are consistent with a smaller immunofluorescence-based survey (3), suggest a considerable difference in exposure to C. ruminantium between animals kept in different parts of the country. The presence of antibodies is likely a good parameter of infection, as small ruminants remain seropositive for several years once they survive a C. ruminantium infection. The high seroprevalence in the south indicates that animals which are introduced in this area are at high risk of becoming infected with C. ruminantium.

To ascertain that the observed apparent difference in exposure was caused by contact with the agent, 10 serologically negative goats (indigenous Landim breed) were translocated from Tete province to the Veterinary Faculty in Maputo in southern Mozambique. After a 10-day quarantine period at the Veterinary Faculty in Maputo, the goats were subdivided into two sentinel herds and placed at two farms south of Maputo (Porto Henrique and Bom Pastor) and were herded together with the local free-ranging goats. The goats were not treated with any acaricides during the trial. Blood samples were collected on a weekly basis for serological monitoring and at the occurrence of a persistent fever (rectal body temperature above 41.0°C) or nervous symptoms. Of the five animals that were translocated to Porto Henrique (Fig. 1), one goat died 10 days after arrival with severe nervous symptoms. Examination of Giemsa-stained brain crushed smears from this animal for the presence of rickettsial inclusion bodies in endothelial cells confirmed the presence of C. ruminantium. MAP-1B ELISA of collected blood samples indicated that three clinically healthy goats at Porto Henrique seroconverted within 35 days. The fifth goat remained seronegative for the entire duration of the study (5 weeks) (Table 2). At the second farm at Bom Pastor (Fig. 1), one goat died 22 days after field exposure with clinical symptoms of heartwater, but this diagnosis could not be confirmed as necropsy could not be performed. A second goat seroconverted without obvious clinical symptoms. Of the remaining three goats one went missing after 1 week and the other two died of other causes (Table 2).

View larger version (37K): [in this window] [in a new window]   FIG. 1.   Map of Mozambique showing the locations where the research was conducted. Arrow, translocation of sentinel goats. Inset, enlargement of Maputo province.

In order to definitively confirm that C. ruminantium was the etiologic agent of the diseased animals and to determine if different isolates were present, DNA was extracted from the blood samples of translocated goats showing clinical signs as well as from animals with cases of heartwater encountered in the south during the field study using the method described by Moreira (9). Part of the 16S rRNA gene (rDNA) was amplified using primer 16SF1 (gggctgcagAGTTTGATCCTGGCTCAG) (15) and primer 16SR8 (GGTTCACCTACAGCTACCTT) and was sequenced using primer 16SF1 on a ABI PRISM 310 sequencer. The entire 16S sequences of three samples were determined elsewhere (Baseclear, Leiden, The Netherlands). Blastn searches (National Center for Biotechnology Information website http://ncbi.nlm.nih.gov) using the obtained sequences revealed that samples from Porto Henrique (goat 1) and Bela Vista (field case of heartwater) were homologous to the C. ruminantium Crystal Springs isolate (4) (Table 3). The sequence of a sample from Bom Pastor (goat 6) was homologous to Ehrlichia sp. strain Omatjenne (1). The sequence of a second sample from Bela Vista was homologous, but not identical, to Anaplasma marginale (Table 4). Since this sample originated from a goat, we believe that it might be Anaplasma ovis, which has been reported to occur in sheep and goats in Mozambique (2). These data show that C. ruminantium and other Ehrlichia sp. were present simultaneously in goats, but it is not clear whether the goats were already infected with the Ehrlichia and Anaplasma species prior to translocation as they were only examined for antibodies against C. ruminantium.

Blood samples from suspected heartwater cases encountered in the south (Bela Vista) during the field study were used for experimental infection of Landim goats in Maputo to confirm the presence of C. ruminantium. Three goats died shortly after infection, and heartwater could be confirmed. A fourth goat seroconverted after a second inoculation since it was treated with antibiotics 2 days after the first inoculation. In The Netherlands three seronegative Texelaar sheep were subinoculated with 4 ml of blood (no. 172 blood from goat 1 at Porto Henrique, no. 173 blood from a field case at Bela Vista, and no. 174 blood from goat 6 at Bom Pastor) to confirm earlier findings and to start in vitro cultures. All three sheep developed fever and were treated with oxytetracyclines. They recovered, and seroconversion was demonstrated by the MAP1-B ELISA (Fig. 2). Despite the fact that sheep 174 seroconverted after treatment, no C. ruminantium 16S sequence homology was found for the sample used to infect this animal. To further investigate if C. ruminantium was present in this blood sample, a fourth sheep was infected (sheep 179). After the animal had succumbed, DNA was extracted from the brain of this animal; rickettsial inclusions were detected in the capillary endothelial cells. A hydropericardium was also detected in this animal, clearly indicating a fatal heartwater case. The 16S sequence obtained from this DNA was identical to the previously obtained sequence of the C. ruminantium Porto Henrique isolate (Table 3), which suggests that the original blood sample collected from goat 6 contained two bacterial species. To confirm this, the 16S PCR product obtained from the DNA extracted from the original sample was cloned and transformed to Escherichia coli. Ten clones were sequenced; 4 were homologous to C. ruminantium, and 6 were homologous to Ehrlichia sp. strain Omatjenne. Whether the presence of Ehrlichia played a role in the outcome of the disease remains to be investigated.

View larger version (19K): [in this window] [in a new window]   FIG. 2.   Rectal body temperature (solid lines) and MAP1-B ELISA results (dashed lines; PP, percentage positive) for four experimentally infected sheep. , sheep 172 (Porto Henrique); , sheep 173 (Bela Vista); , sheep 174 (Bom Pastor); , sheep 179 (Bom Pastor). All reacting animals, except sheep 179, were treated with oxytetracycline at the second day of fever.

These data demonstrate that there is a risk of transmission of C. ruminantium to translocated goats if precautions are not taken and that transmission of C. ruminantium may cause fatal disease. Vaccination prior to translocation and proper tick control might be essential components of a successful restocking program in Mozambique.

Nucleotide sequence accession numbers. The entire 16S sequences of three samples were deposited in GenBank under accession no. AF318021 (C. ruminantium Porto Henrique), AF318022 (C. ruminantium Bela Vista), and AF318023 (Ehrlichia sp. Bom Pastor).