Previous Article | Next Article 
Clinical and Diagnostic Laboratory Immunology, November 2001, p. 1056-1059, Vol. 8, No. 6
Department of Bacteriology, Okayama
University Medical School, 2-5-1 Shikata-cho Okayama,
700-8558,1 Department of
Gastroenterology, Hokkaido University Graduate School of Medicine, N15,
W7, Kita-ku, Sapporo, 060-0815,2 and
Department of Microbiology, Jichi Medical School, 3311-1 Yakushiji Minamikouch-cho Kawauch-Gun,
329-0498,3 Japan
Received 5 April 2001/Returned for modification 24 May
2001/Accepted 23 July 2001
Gastric mucosa-associated lymphoid tissue (MALT) lymphoma is
related to Helicobacter pylori infection. Specifically, it
has been pointed out that pathogenesis of MALT lymphoma involves the 60-kDa heat shock protein (hsp60). To investigate humoral immune responses to the H. pylori hsp60 in patients with
gastroduodenal diseases and patients with MALT lymphoma, the hsp60 of
H. pylori was expressed with a glutathione
S-transferase fusion protein and was purified
(recombinant hsp60). Sera were obtained from H. pylori-positive patients with gastroduodenal diseases (MALT lymphoma, n = 13; gastric ulcer, n = 20; duodenal ulcer, n = 20; gastritis,
n = 20) and from H. pylori-negative
healthy volunteers (n = 9). Sera from patients with
MALT lymphoma were also obtained at two times: before and after
eradication therapy. Antibodies to hsp60 and H. pylori were
assessed by enzyme-linked immunosorbent assay. The levels of
immunoglobulin G (IgG) antibodies to the hsp60 of H. pylori-positive patients with gastroduodenal diseases were
significantly elevated compared to those in the controls. The levels of
IgG1 antibodies to hsp60 were elevated and correlated with the levels
of anti-H. pylori antibodies in patients with MALT
lymphoma. Humarol immunity against hsp60 may be important and relevant
to gastroduodenal diseases induced by H. pylori infection.
Helicobacter
pylori is now recognized as a cause of gastritis, peptic ulcer,
gastric cancer, and gastric mucosa-associated lymphoid tissue (MALT)
lymphoma (9, 19). Several H. pylori pathogenic
factors, including CagA and VacA, may contribute to the gastric
mucosal damage (6, 7). In recent years, it has also been
accepted that host immune reactions play an important role in the
pathogenesis of H. pylori infection. Although H. pylori is a noninvasive bacterium and is restricted to gastric
epithelial cells, infection with H. pylori induces humoral
and cellular immune responses in the gastric mucosa (16,
22). Bacterial attachment causes induction of interleukin-8
(IL-8) release, and Cag proteins evoke activation of nuclear
factor- Heat shock proteins (hsp's) are immunodominant antigens in various
diseases including H. pylori infection (4, 26).
Our previous studies have shown that the 60-kDa hsp (hsp60) is
expressed in the follicular dendritic cells of the gastric mucosa in
patients with gastric MALT lymphoma (15) and that
antibodies to human hsp60 can be detected in MALT lymphoma patients
(14). These results indicate that hsp60 may be associated
with the host immune reaction in H. pylori infection,
specifically, the pathogensis of gastric MALT lymphoma.
In the present study, H. pylori hsp60 recombinant protein
was expressed, and the levels of immunoglobulin G (IgG), IgG1, IgG2, IgM, and IgA antibodies to hsp60 in sera were measured in patients with
gastric ulcer, duodenal ulcer, gastritis, and gastric MALT lymphoma to
demonstrate the immunological role of hsp60 in H. pylori-infected patients.
Patients.
Sera were obtained from 73 H. pylori-positive patients, including 13 patients with gastric MALT
lymphoma (5 women and 8 men; mean age, 56.6 years), 20 patients with
gastric ulcer (3 women and 17 men; mean age, 46.3 years), 20 patients
with duodenal ulcer (10 women and 10 men; mean age, 30.4 years), and 20 patients with gastritis (6 women and 14 men; mean age, 41.5 years).
Sera were also obtained from nine H. pylori-negative
volunteers (six women and three men; mean age, 37.9 years old).
Informed consent was obtained from each patient and healthy volunteer.
In nine patients with gastric MALT lymphoma who were treated with
eradication therapy (a 1-week course of omeprazole at 40 mg/day,
amoxicillin at 1,500 mg/day, and clarithromycin at 400 mg/day),
endoscopic findings and histopathology were assessed 6 months after
therapy and serum samples were collected. All sera were collected at
the Hokkaido University Hospital and were stored at Diagnosis.
The histology of MALT lymphoma was assessed
according to the Wotherspoon classification. All the lymphomas
were diagnosed as low-grade MALT lymphoma. Diagnosis of the other
diseases was determined according to the symptoms and by endoscopy.
Infection with H. pylori was confirmed by culture, the rapid
urease test, and histology of gastric biopsy specimens and by the
presence of serum antibodies to H. pylori as detected by
enzyme-linked immunosorbent assay (ELISA) (14). H. pylori was detected in the gastric mucosae of all patients whose
sera were positive for anti-H. pylori antibodies. In the
healthy control volunteers, negativity for H. pylori
infection was defined by serology.
Cloning, expression, and purification of recombinant
protein.
The hsp60 protein of H. pylori was expressed
as a glutathione S-transferase fusion protein by PCR
cloning. PCR primers were designed on the basis of sequences published
in GenBank. To facilitate cloning, restriction endnuclease cleavage
sites were included in the PCR primer sequence. The PCR primer pair of
GGAGGATCCCCATGGCAAAAGAAATCAAATTT and
GGGGTCGACCATCATGCCGCCCATGCCTCC was used to amplify the open reading frame from purified H. pylori ATCC 43504 genomic DNA.
1071-412X/01/$04.00+0 DOI: 10.1128/CDLI.8.6.1056-1059.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Immunoglobulin G1 Antibody Response to
Helicobacter pylori Heat Shock Protein 60 Is Closely
Associated with Low-Grade Gastric Mucosa-Associated Lymphoid
Tissue Lymphoma
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
B and release of IL-8 that may support leukocyte attachment
during inflammation (8, 17, 21). However, the bacterial
antigens associated with inflammation are still not clear.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
80°C.
. Recombinant protein was expressed at 25°C in
Luria-Bertani broth containing 2% glucose and ampicillin (100 µg/ml). At an optical density (OD) at 540 nm of 0.6 to 0.8, the
culture was induced with 0.1 mM
isopropyl-
-D-thiogalactopyranoside and was incubated at
37°C for 3 h. The cells were harvested by centrifugation at
7,000 × g for 10 min and resuspended in ice-cold phosphate-buffered saline (PBS). The bacterial suspension was frozen at
70°C and thawed, and the cells were disrupted by sonication on ice
for 2 min with a probe sonicator (Astron) set to full power. Soluble
fusion protein expressed by the glutathione
S-transferase-hsp clone (hsp60) was purified by
glutathione-Sepharose 4B (Amersham Pharmacia) affinity chromatography
according to the manufacturer's instructions.
ELISA for detection of antibodies to hsp60 and H. pylori. Serum antibodies to hsp60 and H. pylori were measured by ELISA. Ninety-six-well microtiter plates were coated with hsp60 fusion protein (10 µg/ml) or H. pylori lysate (50 µg/ml) in 100 µl of 0.1 M carbonate-bicarbonate buffer (pH 9.6) overnight at 4°C. After the wells were blocked with PBS containing 10% skim milk, the plates were incubated with sera, at a 1:100 dilution for hsp60 antibody or 1:1,000 for H. pylori antibody, for 2 h and washed with PBS containing 0.05% Tween 20. Peroxidase-labeled rabbit anti-human IgA, IgM, or IgG antibody (DAKO Japan) was then added, and the plates was incubated for 2 h. After the plate was washed, the wells were reacted with 1 mg of o-phenylenediamine (Wako Pure Chemical) per ml in citrate buffer (pH 5.5). The ODs were measured at 490 nm on an ELISA plate reader (Bio-Rad). Cutoff ODs were determined as the mean plus 2 times the standard deviation for the sera obtained from negative controls.
For the detection of IgG1 or IgG2 antibodies, the contents of the wells of the microtiter plates were reacted with human sera as described above. Anti-human IgG1 or IgG2 monoclonal antibodies (Pharmingen) were then added, and the plates were incubated for 2 h, followed by washing. The wells were continuously reacted with anti-mouse antibody conjugated with horseradish peroxidase (DAKO Japan). After the plates were washed, the enzyme reaction described above was used for final color development.Statistical analysis. Differences in the ODs of the antibodies among the disease groups were evaluated by the Student t test. Correlation between antibodies to H. pylori and hsp60 were evaluated with Pearson's correlation coefficient. P values of <0.05 were considered to represent a significant difference.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
IgG, IgM, and IgA antibodies to hsp60.
The levels of IgG
antibodies to H. pylori whole antigens and hsp60 in
the sera of patients with gastroduodenal diseases were significantly
higher than those in the sera of healthy control (Fig. 1A and
B). The cutoff ODs of the ELISA for
anti-whole-antigens and hsp60 antibodies were 0.59 and 1.20 respectively. The specificity and sensitivity of IgG antibodies to the
whole antigens were 100 and 91.8%, respectively and the sensitivity
and specificity of IgG antibodies to hsp60 were 100 and 69.9%
respectively. The levels of IgM antibodies and IgA antibodies were
elevated, but they were not significantly different from those in the
control group (Fig. 1C and D).
|
Correlation coefficient between IgG and IgG1 antibodies to hsp60
and H. pylori.
IgG isotype antibodies were measured in
patients with gastroduodenal diseases. The levels of IgG1 antibodies to
H. pylori and hsp60 were significantly elevated in patients
with gastroduodenal diseases compared with the levels in the control
group. However, the levels of IgG2 antibodies to both H. pylori whole antigens and hsp60 were increased in patients, but
the difference was not statistically significant (data not
shown). We statistically analyzed correlations between IgG antibodies
to H. pylori and IgG1 antibodies to hsp60 in the patients.
The patients with MALT lymphoma had a high correlation coefficient,
although patients with other disease had only low correlation
coefficients (Fig. 2).
|
IgG antibodies after eradication therapy in patients with MALT
lymphoma.
We studied the change in total IgG antibody levels after
eradication therapy in nine patients with MALT lymphoma. Eradication therapy resulted in histological and endscopic remission in six MALT
lymphoma patients; however, three patients did not have a regression 6 months after eradication therapy. IgG antibody levels to whole H. pylori and hsp60 in the patients with regression were significantly decreased (Fig. 3A and B).
One levels of IgG antibodies to hsp60 in patients with or without
regressions were decreased following eradication therapy, and at
pretreatment levels of IgG antibody to hsp60 in the six patients with
regressions were significantly higher than those in the three patients
without regressions (Fig. 3B).
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
We have reported on the measurement of the levels of immunoglobulin antibody against hsp60 in H. pylori-infected patients. Specifically, the IgG1 response against hsp60 is closely associated with MALT lymphoma in H. pylori-infected patients. IgG1 antibodies are produced by B cells activated under the T-helper 2 (Th2) cytokine IL-4. Th1 cells that produce gamma interferon are able to promote the production of IgG2 opsonizing and complement-fixing antibodies. An IgG subclass response to H. pylori in patients with chronic active gastritis and duodenal ulcer was reported by Bontkes et al (5). They indicated that the titers of IgG1 antibodies to the bacteria were raised in patients with H. pylori infection and that the titers of IgG2 antibodies in duodenal ulcer patients were higher than those in gastritis patients. In this study, there was a strong correspondence between total serum anti-H. pylori and anti-hsp60 IgG levels in patients with gastritis; however, the correspondence for IgG1 and IgG2 antibodies individually was weak. The anti-hsp60 IgG1 antibodies of patients with MALT lymphoma had a strong correspondence with anti-H. pylori IgG1 antibodies. The results indicate that a long-standing H. pylori infection induced the Th-2 reaction against hsp60 in patients with gastric MALT lymphoma.
We have reported that autoimmunity through human hsp60 is involved in patients with MALT lymphoma (14, 15) and that it may be caused by a long-term Th-2 reaction against bacterial hsp60. Infection with H. pylori also leads to an IgG response against the bacteria and hsp60 in patients with peptic ulcer and gastritis. We assessed the anti-hsp60 IgG antibody titers in a few patients with peptic ulcers and found that total levels of IgG to hsp60 were decreased by antibacterial eradication therapy (data not shown). However, the responses of Th-1 (IgG2) and/or Th-2 (IgG1) were diverse in patients with gastritis and peptic ulcer; hence, gastritis and ulcer diseases may be characterized by the development of cellular or humoral immune responses at various stages.
Some markers related to the pathogenesis of gastric MALT lymphoma have been investigated. Homozygous p16 tumor suppressor gene deletion was found in the gastric mucosae of patients with high-grade MALT lymphoma but were not found in those of patients with gastritis (18). The cell cycle regulatory gene (cdc2/cdk1) might play an important role in the modulation of cellular death, proliferation, and translation during the evolution of chronic gastritis to MALT lymphoma (3). PCR detection of IgH rearrangement in gastric biopsy specimens could be used to monitor MALT lymphoma regression during treatment (1). These observations about host epithelial cell growth and/or lymphocyte regulations indicated that some bacterial antigens were involved in the progression of the gastric lesion of MALT lymphoma; however, the bacterial antigen was not clearly detected. The present study showed that the levels of IgG antibodies against hsp60 are markedly decreased during eradication therapy and may possibly be used as a marker of the host immune reactions in patients with MALT lymphoma.
Bacterial virulence factors, like CagA and VacA s1, show a strong association with duodenal ulcer disease (2, 20, 23). Serological study of patients indicated that MALT lymphoma is associated with H. pylori strains expressing the CagA protein (10). On the other hand, a large variety of H. pylori strains could be considered responsible for the induction of MALT lymphoma, as judged from the heterogeneity of their antigenic properties and the fact that CagA did not seem to be a virulence marker associated with the disease in Japan (13). H. pylori infection induces class II major histocompatibility complex expression and CD4-positive T-cell activation (11); however, antigens associated with lymphocyte activation were not detected. We have reported that local immunoglobulin against hsp60 is associated with infiltrating cell numbers in the gastric mucosae of patients with gastritis (12) and have also reported that anti-hsp60 antibodies are relevant to gastric inflammation in patients with peptic ulcer during eradication therapy (25). In addition, the level of expression of CD40L on the peripheral blood mononuclear cells (PBMCs) of patients with MALT lymphoma was increased by cytokines (granulocyte-macrophage colony-stimulating factor and IL-4) or by cytokine plus hsp60 stimulation compared to the level of expression on PBMCs of patients with gastritis or healthy volunteers. The production of IL-4 in PBMC cultures was also increased by cytokines and/or hsp60 stimulation in patients with MALT lymphoma. In patients with MALT lymphoma, however, the level of production of gamma interferon was at the low end (24). Hence, hsp60 may be an important antigen for the production of antibodies and T-cell activation in patients with H. pylori infection.
In conclusion, the present study indicated that H. pylori infection induced an IgG1 response (humoral Th-2 immunity) against hsp60 in patients with MALT lymphoma, and that may be a disposition of MALT lymphoma as a host factor. This study also indicated that hsp60 is an immunodominant antigen in H. pylori infection, and analysis of the subclass of IgG antibody to hsp60 may be used to assess the immunological future in patients with H. pylori-associated diseases. This information will provide immunological data that can be used to make diagnoses once further studies have been conducted.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Bacteriology, Okayama University Medical School, 2-5-1 Shikata-cho Okayama, 700-8558, Japan. Phone and fax: 81-86-235-7162. E-mail: kuma{at}med.okayama-u.ac.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Aiello, A., R. Giardini, C. Tondini, M. Balzarotti, T. Diss, H. Peng, D. Delia, and S. Pilotti. S. 2000. PCR-based clonality analysis: a reliable method for the diagnosis and follow-up monitoring of conservatively treated gastric B-cell MALT lymphomas? Histopathology 34:326-330. |
| 2. | Atherton, J. C., R. M. Peek, Jr., K. T. Tham, T. L. Cover, and M. J. Blaser. 1997. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology 112:92-99[CrossRef][Medline]. |
| 3. |
Banerjee, S. K.,
A. P. Weston,
M. N. Zoubine,
D. R. Campbell, and R. Cherian.
2000.
Expression of Cdc2 and cycline B1 in Helicobacter pylori-associated gastric MALT and MALT lymphoma.
Am. J. Pathol.
156:217-225 |
| 4. | Barton, S. G., V. R. Winrow, D. S. Rampton, J. E. Crabtree, I. L. Beales, and J. Calam. 1998. Circulating antibodies to the 60-kD heat shock protein (hsp) family in patients with Helicobacter pylori infection. J. Clin. Exp. Immunol. 112:490-494[CrossRef][Medline]. |
| 5. | Bontkes, H. J., R. A. Veenendaal, A. S. Pena, J. G. Goedhard, W. van Duijn, J. Kuiper, J. L. Meijer, and C. B. Lamers. 1992. IgG subclass response to Helicobacter pylori in patients with chronic active gastritis and duodenal ulcer. Scand J. Gastroenterol. 27:129-133[Medline]. |
| 6. |
Covacci, A.,
S. Censini,
M. Bugnoli,
R. Petracca,
D. Burroni,
G. Macchia,
A. Massone,
E. Papini,
Z. Y. Xiang,
N. Figura, and R. Rappuolli.
1993.
Molecular characterization of the 128kDa immunodominant antigen of Helicobacter pylori associated cytotoxicity and duodenal ulcer.
Proc. Natl. Acad. Sci. USA
90:5791-5795 |
| 7. | Cover, T. L., and M. J. Blaser. 1992. Purification and characterization of the vacuolating toxin from Helicobacter pylori. J. Biol. Chem. 265:10570-10575. |
| 8. |
Crabtree, J. E.,
A. Covacci,
S. M. Farmery,
Z. Xiang,
S. Tompkins,
S. Perry,
I. J. Lindley, and R. Rappuoli.
1995.
Helicobacter induced interleukin-8 expression in gastric epithelial cells is associated with CagA positive phenotype.
J. Clin. Pathol.
48:41-45 |
| 9. | Dunn, B. E., H. Cohen, and M. J. Blaser. 1997. Helicobacter pylori. Clin. Microbiol. Rev. 10:720-741[Abstract]. |
| 10. | Eck, M., B. Schmausser, R. Hass, A. Greiner, S. Czub, and H. K. Muller-Hermelink. 1997. MALT-type lymphoma of the stomach is associated with Helicobacter pylori strains expressing the CagA protein. Gastroenterology 112:1482-1486[CrossRef][Medline]. |
| 11. |
Fan, X.,
S. E. Crowe,
S. Behar,
H. Gunasena,
G. Ye,
H. Haeberle,
N. Van Houten,
W. K. Gourley,
P. B. Ernst, and V. E. Reyes.
1998.
The effect of class II major histocompatibility complex expression on adherence of Helicobacter pylori and induction of apoptosis in gastric epithelial cells: a mechanism for T helper cell type 1-mediated damage.
J. Exp. Med.
187:1659-1669 |
| 12. | Hayashi, S., S. Sugiyama, K. Hisano, T. Awakawa, I. Kurokawa, A. Yachi, H. Isogai, E. Isogai, K. Yokota, Y. Hirai, K. Oguma, and N. Fujii. 1996. Quantitative detection of secretory immunoglobulin A to Helicobacter pylori in gastric juice: antibody capture enzyme-linked immunosorbent assay. J. Clin. Lab. Anal. 10:74-77[CrossRef][Medline]. |
| 13. | Ito, Y., T. Azuma, S. Ito, H. Miyaji, M. Hirai, Y. Yamazaki, F. Sato, T. Kato, Y. Kohli, and M. Kuriyama. 1997. Analysis and typing of the vacA gene from cagA-positive strains of Helicobacter pylori isolated in Japan. J. Clin. Microbiol. 35:1710-1714[Abstract]. |
| 14. |
Kawahara, Y.,
K. Yokota,
M. Mizuno,
N. Yunoki,
T. Uetsu,
H. Okada,
K. Kobayashi,
Y. Hirai,
K. Oguma, and T. Tsuji.
1999.
Antibodies to human gastric epithelial cell and heat shock protein 60 in Helicobacter pylori positive mucosa associated lymphoid tissue lymphoma.
Gut
45:20-23 |
| 15. | Kobayashi, K., K. Yokota, T. Yoshino, Y. Kawahara, A. Dey, Y. Hirai, K. Oguma, and T. Akagi. 1998. Detection of Helicobacter pylori associated antigen and heat shock protein 60 on follicular dendritic cells in the germinal centres of low grade B cell lymphoma of gastric mucosa associated lymphoid tissue (MALT). J. Clin. Pathol. 51:396-398[Abstract]. |
| 16. |
Mattsson, A.,
M. Quiding-Jarbrink,
H. Hoonroth,
A. Hamlet,
I. Ahlistedt, and A.-M. Svennerholm.
1998.
Antibody-secreting cells in the stomachs of symptomatic and asymptomatic Helicobacter pylori-induced subjects.
Infect. Immun.
66:2705-2712 |
| 17. |
Mori, N.,
A. Wada,
T. Hirayama,
T. P. Parks,
C. Stratowa, and N. Yamamoto.
2000.
Activation of intercellular adhesion molecule 1 expression by Helicobacter pylori is regulated by NF-B in gastric epithelial cancer cells.
Infect. Immun.
68:1806-1814 |
| 18. | Neumeister, P., G. Hoefler, C. Beham-Schmid, H. Schmidt, U. Apfelbeck, H. Schaider, W. Linksch, and H. Sill. 1997. Deletion analysis of the p16 tumor suppressor gene in gastrointestinal mucosa-associated lymphoid tissue lymphomas. Gastroenterology 112:1871-1875[CrossRef][Medline]. |
| 19. |
Parsonnet, J.,
S. Hansen,
L. Rodriguez,
A. B. Gelb,
R. A. Warnke,
E. Jellum,
N. Orentreich,
J. H. Vogelman, and G. D. Friedman.
1994.
Helicobacter pylori infection and gastric lymphoma.
N. Engl. J. Med.
330:1267-1271 |
| 20. |
Rudi, J.,
C. Kolb,
M. Maiwald,
D. Kuck,
A. Sieg,
P. R. Galle, and W. Stremmel.
1998.
Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases.
J. Clin. Microbiol.
36:944-948 |
| 21. |
Sharma, S. A.,
M. K. Tummuru,
M. J. Blaser, and L. D. Kerr.
1998.
Activation of IL-9 gene expression by Helicobacter pylori is regulated by transcription factor nuclear factor-kappa B in gastric epithelial cells.
J. Immunol.
160:2401-2407 |
| 22. |
Sommer, F.,
G. Faller,
P. Konturek,
T. Kirchner,
E. G. Hahn,
J. Zeus,
M. Rollinghoff, and M. Lohoff.
1998.
Antrum- and corpus mucosa-infiltrating CD4+ lymphocytes in Helicobacter pylori gastritis display a Th1 phenotype.
Infect. Immun.
66:5543-5546 |
| 23. | van Doon, L. J., C. Figueiredo, R. Sanna, A. Plaisier, P. Schneeberger, W. de Boer, and W. Quint. 1998. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 115:58-66[CrossRef][Medline]. |
| 24. | Yamasaki, R., K. Kobayashi, K. Yokota, S. Takada, E. Ishii, H. Okada, T. Yoshino, K. Oguma, and T. Akagi. 2000. Study of CD40 ligand expression by antigen stimulation with H. pylori-HSP60. Gut 47(Suppl.):A40-A41[CrossRef]. |
| 25. |
Yunoki, N.,
K. Yokota,
M. Mizuno,
Y. Kawahara,
M. Adachi,
M. Okada,
S. Hayashi,
Y. Hirai,
K. Oguma, and T. Tsuji.
2000.
Antibody to heat shock protein can be used for early serological monitoring of Helicobacter pylori eradication treatment.
Clin. Diagn. Lab. Immunol.
7:574-577 |
| 26. |
Zugel, U., and S. H. Kaufmann.
1999.
Role of heat shock proteins in protection from and pathogenesis of infectious diseases.
Clin. Microbiol. Rev.
12:19-39 |
Clinical and Diagnostic Laboratory Immunology, November 2001, p. 1056-1059, Vol. 8, No. 6
1071-412X/01/$04.00+0 DOI: 10.1128/CDLI.8.6.1056-1059.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sgouros, S N, Bergele, C
(2006). Clinical outcome of patients with Helicobacter pylori infection: the bug, the host, or the environment?. Postgrad. Med. J.
82: 338-342
[Abstract] [Full Text] -
Lin, S.-N., Ayada, K., Zhao, Y., Yokota, K., Takenaka, R., Okada, H., Kan, R., Hayashi, S., Mizuno, M., Hirai, Y., Fujinami, Y., Oguma, K.
(2005). Helicobacter pylori heat-shock protein 60 induces production of the pro-inflammatory cytokine IL8 in monocytic cells. J Med Microbiol
54: 225-233
[Abstract] [Full Text] -
Takenaka, R., Yokota, K., Ayada, K., Mizuno, M., Zhao, Y., Fujinami, Y., Lin, S.-N., Toyokawa, T., Okada, H., Shiratori, Y., Oguma, K.
(2004). Helicobacter pylori heat-shock protein 60 induces inflammatory responses through the Toll-like receptor-triggered pathway in cultured human gastric epithelial cells. Microbiology
150: 3913-3922
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»